Entry information : ParcLiP04
Entry ID 12292
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2018-01-18 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-01-18 (Catherine Mathe)
Peroxidase information: ParcLiP04
Name ParcLiP04
Class Lignin peroxidase    [Orthogroup: LiP004]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Polyporaceae Polyporus
Organism Polyporus arcularius    [TaxId: 5639 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ParcLiP04
start..stop
S start..stop
ParcLiP02 694 0 1..365 1..365
ParcLiP05 678 0 1..365 1..365
ParcLiP01 660 0 1..364 1..364
ParcLiP03 612 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 26300..26360 61 N° 2 25901..26240 340 N° 3 25730..25851 122 N° 4 25180..25676 497
N° 5 25062..25126 65 N° 6 24997..25009 13  
complement(join(24997..25009,25062..25126,25180..25676,25730..25851,25901..26240 ,26300..26360))


exon

Literature and cross-references ParcLiP04
DNA ref. JGI genome:   scaffold_193 (26360..24997)
Cluster/Prediction ref. JGI gene:   599508
Protein sequence: ParcLiP04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   365 (344)
PWM (Da):   %s   38910.49 (36725.2)  
PI (pH):   %s   4.42 (4.34) Peptide Signal:   %s   cut: 22 range:22-365
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFKALLSTLAVVATLKVASAALTRRVACPDGKNTATNAACCALFPIRDDIVENLFHNQCAEEAHESLRLTFHDAVAFSPAAEARGEFAGGGADGSIVLFSEIETAFHANGGTDEIVALQKPFIAKHNISAADFIQFAGAVALAQCPGAPQLEFMLGRKDATRAAPDGLVPEPFDTIDDILARLLDVGFQDFEVVWLLSAHTVAAADLVDPTIPRTPFDSTPEVFDTQFFIETQLRGLKFAGQGGIHGEVNSPLTGEMRLQSDHLLARDSRTACEWQSFTNDQEKFAETFPDVMGRLALLGVDQSTLIDCSEVIPIAPPLPASSRPHFPAGKTHADIEQACADTPFPTFPTDPGPATKVAPVPNL*

Retrieve as FASTA  
Remarks complete sequence from genomics (5 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCAAGGCTCTCCTCTCTACCCTCGCCGTCGTTGCAACTCTCAAGGTCGCCAGCGGTGAGTCTTTCGCGGGCTGCTGCCACTTTCCTCAATGCTGACTGCTAGCTGTCCGGTAG

CTGCGCTTACGCGCCGTGTTGCATGCCCGGATGGGAAGAACACCGCGACGAACGCGGCGTGCTGCGCTCTGTTCCCTATCCGCGACGACATCGTCGAGAACCTCTTCCACAACCAGTGCG
CAGAGGAGGCCCACGAGTCCCTCCGTCTGACCTTCCACGACGCCGTCGCGTTCTCGCCCGCTGCCGAAGCCCGTGGCGAGTTCGCTGGCGGAGGCGCCGACGGCTCCATCGTGCTCTTCT
CTGAGATCGAGACGGCGTTCCATGCAAACGGGGGCACCGACGAGATCGTCGCGCTGCAGAAGCCCTTCATCGCCAAGCACAACATCTCGGCCGCTGACTT
GTATGCCATCCTTGTCCTCT
GTCCGTGCAGGTGCTTACGTGCTTCGTAGCATTCAATTTGCGGGCGCCGTCGCGCTCGCTCAGTGCCCTGGTGCACCCCAGCTCGAGTTCATGCTCGGCCGTAAGGATGCTACGCGGGCT
GCCCCTGACGGTCTCGTCCCCGAGCCCTTCG
GTGAGTAGCCACGTCGCTCTGTGACTAGTACCCAAAGCTGAGTCGATCGTTAGACACTATCGATGACATCCTGGCCCGTCTGCTCGACG
TCGGGTTCCAGGACTTCGAGGTCGTATGGTTGCTCTCCGCCCACACAGTCGCCGCCGCCGACCTGGTCGACCCGACGATCCCGCGCACGCCCTTCGACTCGACGCCGGAGGTCTTCGACA
CCCAGTTCTTCATCGAGACCCAGCTCCGTGGTCTGAAGTTCGCCGGCCAGGGCGGTATCCACGGCGAGGTCAACTCGCCGCTCACCGGCGAGATGCGCCTCCAGTCGGACCACCTCCTCG
CTCGCGACTCGCGCACGGCCTGCGAGTGGCAGTCGTTCACAAACGACCAGGAGAAGTTCGCGGAGACGTTCCCGGATGTTATGGGCCGCCTTGCGCTCCTCGGTGTTGATCAGAGCACGC
TCATCGACTGCTCGGAGGTCATTCCGATCGCCCCGCCCCTGCCCGCCAGCTCTCGCCCGCACTTCCCCGCTGGCAAGACCCACGCCGACATCGAGCAGGCT
GTAAGTGGACATGCATGTT
GCAATGTTGCGCATCGTGCTGACCTTGTTTATAGTGCGCCGACACCCCGTTCCCGACCTTCCCCACTGACCCTGGTCCGGCCACCAAGGTCGCCCCCGTGTAAGCATCTGATGTCCGTCC
GTTTTTCGCTGCTCTAACACGCTCGGTTCAGTCCCAACCTATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCAAGGCTCTCCTCTCTACCCTCGCCGTCGTTGCAACTCTCAAGGTCGCCAGCGCTGCGCTTACGCGCCGTGTTGCATGCCCGGATGGGAAGAACACCGCGACGAACGCGGCG
TGCTGCGCTCTGTTCCCTATCCGCGACGACATCGTCGAGAACCTCTTCCACAACCAGTGCGCAGAGGAGGCCCACGAGTCCCTCCGTCTGACCTTCCACGACGCCGTCGCGTTCTCGCCC
GCTGCCGAAGCCCGTGGCGAGTTCGCTGGCGGAGGCGCCGACGGCTCCATCGTGCTCTTCTCTGAGATCGAGACGGCGTTCCATGCAAACGGGGGCACCGACGAGATCGTCGCGCTGCAG
AAGCCCTTCATCGCCAAGCACAACATCTCGGCCGCTGACTT
CATTCAATTTGCGGGCGCCGTCGCGCTCGCTCAGTGCCCTGGTGCACCCCAGCTCGAGTTCATGCTCGGCCGTAAGGAT
GCTACGCGGGCTGCCCCTGACGGTCTCGTCCCCGAGCCCTTCG
ACACTATCGATGACATCCTGGCCCGTCTGCTCGACGTCGGGTTCCAGGACTTCGAGGTCGTATGGTTGCTCTCCGCC
CACACAGTCGCCGCCGCCGACCTGGTCGACCCGACGATCCCGCGCACGCCCTTCGACTCGACGCCGGAGGTCTTCGACACCCAGTTCTTCATCGAGACCCAGCTCCGTGGTCTGAAGTTC
GCCGGCCAGGGCGGTATCCACGGCGAGGTCAACTCGCCGCTCACCGGCGAGATGCGCCTCCAGTCGGACCACCTCCTCGCTCGCGACTCGCGCACGGCCTGCGAGTGGCAGTCGTTCACA
AACGACCAGGAGAAGTTCGCGGAGACGTTCCCGGATGTTATGGGCCGCCTTGCGCTCCTCGGTGTTGATCAGAGCACGCTCATCGACTGCTCGGAGGTCATTCCGATCGCCCCGCCCCTG
CCCGCCAGCTCTCGCCCGCACTTCCCCGCTGGCAAGACCCACGCCGACATCGAGCAGGCT
TGCGCCGACACCCCGTTCCCGACCTTCCCCACTGACCCTGGTCCGGCCACCAAGGTCGCC
CCCGT
TCCCAACCTATAA

Retrieve as FASTA