Entry information : ParcLiP06
Entry ID 12300
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2018-01-18 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-01-18 (Catherine Mathe)
Peroxidase information: ParcLiP06
Name ParcLiP06
Class Lignin peroxidase    [Orthogroup: LiP004]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Polyporaceae Polyporus
Organism Polyporus arcularius    [TaxId: 5639 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ParcLiP06
start..stop
S start..stop
ParcLiP02 625 0 1..368 1..365
ParcLiP05 625 0 1..368 1..365
ParcLiP01 621 0 1..367 1..364
ParcLiP04 608 0 1..368 1..365
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 26537..26606 70 N° 2 26271..26475 205 N° 3 26069..26203 135 N° 4 25894..26015 122
N° 5 25340..25836 497 N° 6 25222..25286 65 N° 7 25155..25167 13  
complement(join(25155..25167,25222..25286,25340..25836,25894..26015,26069..26203 ,26271..26475,26537..26606))


exon

Literature and cross-references ParcLiP06
DNA ref. JGI genome:   scaffold_225 (26606..25155)
Cluster/Prediction ref. JGI gene:   142163
Protein sequence: ParcLiP06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   368 (347)
PWM (Da):   %s   39449.94 (37366.8)  
PI (pH):   %s   4.59 (4.54) Peptide Signal:   %s   cut: 22 range:22-368
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKALLAAVSLIAALQGASGSPAQLTRRVACPDGKNTATNAACCALFPVRDDIIKNLFHNQCAEEAHESFRLTFHDAVAFSPAAEAEGKFAGGGADGSIVLFDKIETNFHANQGTDEIVALQKPIIARHSISTADFVQFAGAVGLSLCPGAPQVQFLLGRKDATRPAPDGLVPEPFDSVDKILARLLDVGFQDFEVVWLLSAHTIAAADFVDPTIPRTPFDSTPEIFDTQFFIETQLKGTSFPGKGANQGEVLSPLRGEMRLQSDFLIARDNRTACEWQSFTNDQEKFQETFPDVFGRLAVLGVDNSTLIDCSEVLPVPPPLPRSAVPHFPAGKSIRDVEPACAETPFPTFPTDPGPATTIARVPNV*

Retrieve as FASTA  
Remarks complete sequence from genomics (5 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAAGCTCTGCTCGCCGCCGTCTCTCTCATCGCCGCCCTCCAGGGTGCCAGCGGTTCTCCGGGTACGCAGTCCTCGTGCACATCCACGGCTCTGGTGGCATCCTGACAATGG
TCCTCCTACAGCCCAGCTGACCCGCCGCGTCGCCTGCCCCGACGGCAAGAACACGGCGACTAACGCGGCGTGCTGCGCGCTCTTCCCCGTCCGGGACGACATCATCAAGAACCTCTTCCA
CAACCAGTGCGCTGAGGAGGCCCACGAGTCCTTCCGCCTCACCTTCCACGACGCCGTCGCCTTCTCGCCCGCGGCCGAGGCCGAGGGCAAGTTCGC
GTGAGCATCCACCACTTGCCTTCT
TCCCGTTTGACAGAGCGGCCAGCTGACCACCCTAACTCTGCAGTGGCGGAGGAGCCGACGGCTCTATCGTCCTCTTCGACAAGATCGAGACGAACTTCCACGCCAACCAGGGTACCGACG
AGATCGTTGCGCTGCAGAAGCCCATCATTGCGCGCCACAGTATCTCGACTGCTGACTT
GTACGTCTGCACTTCCTTACACGCACAGACTGAGTATCTGACACCCGCTGAAGCGTCCAGTT
CGCCGGCGCCGTCGGTCTGTCTCTGTGCCCCGGTGCACCCCAGGTCCAGTTCCTGCTCGGTCGCAAGGATGCCACCCGGCCCGCTCCCGATGGCCTGGTTCCCGAGCCCTTCG
GTAAGCC
CTCTCAGGCCACATCTCCGTCCACTCCCACACTGACACATGGCCGCACAGACTCGGTCGACAAGATCCTGGCCCGTCTCCTCGACGTCGGTTTCCAGGACTTCGAGGTCGTCTGGCTGCT
CTCCGCGCACACCATCGCCGCCGCCGACTTCGTCGACCCCACCATCCCGCGCACGCCCTTCGACTCCACCCCCGAGATCTTCGACACGCAGTTCTTCATCGAGACCCAGCTCAAGGGCAC
GTCCTTCCCCGGCAAAGGCGCCAACCAGGGCGAGGTCCTCTCCCCGCTCCGCGGCGAGATGCGCCTCCAGTCCGACTTCCTGATCGCCCGCGACAACCGCACCGCGTGCGAGTGGCAGTC
GTTCACCAACGACCAGGAGAAGTTCCAGGAGACGTTCCCCGACGTCTTCGGCCGCCTCGCCGTCCTCGGTGTCGACAACAGCACCCTCATCGACTGCTCCGAGGTTCTCCCGGTGCCCCC
GCCCCTCCCGCGCAGCGCTGTCCCCCACTTCCCCGCCGGAAAGTCCATCCGCGACGTCGAGCCCGCT
GTAAGTTGTCCTGGCCATCCGTACATTGCTGAGCCTAACCTCTGCATCCACAG

TGCGCTGAGACTCCCTTCCCCACCTTCCCGACCGACCCCGGTCCGGCCACCACGATCGCTCGCGT
GTAAGTCCCTCTTCACACTTCGATAGCGAGATTTCTTTTGACCTTGCCTCGCAGT
CCCAACGTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAAGCTCTGCTCGCCGCCGTCTCTCTCATCGCCGCCCTCCAGGGTGCCAGCGGTTCTCCGGCCCAGCTGACCCGCCGCGTCGCCTGCCCCGACGGCAAGAACACGGCGACT
AACGCGGCGTGCTGCGCGCTCTTCCCCGTCCGGGACGACATCATCAAGAACCTCTTCCACAACCAGTGCGCTGAGGAGGCCCACGAGTCCTTCCGCCTCACCTTCCACGACGCCGTCGCC
TTCTCGCCCGCGGCCGAGGCCGAGGGCAAGTTCGC
TGGCGGAGGAGCCGACGGCTCTATCGTCCTCTTCGACAAGATCGAGACGAACTTCCACGCCAACCAGGGTACCGACGAGATCGTT
GCGCTGCAGAAGCCCATCATTGCGCGCCACAGTATCTCGACTGCTGACTT
CGTCCAGTTCGCCGGCGCCGTCGGTCTGTCTCTGTGCCCCGGTGCACCCCAGGTCCAGTTCCTGCTCGGT
CGCAAGGATGCCACCCGGCCCGCTCCCGATGGCCTGGTTCCCGAGCCCTTCG
ACTCGGTCGACAAGATCCTGGCCCGTCTCCTCGACGTCGGTTTCCAGGACTTCGAGGTCGTCTGGCTG
CTCTCCGCGCACACCATCGCCGCCGCCGACTTCGTCGACCCCACCATCCCGCGCACGCCCTTCGACTCCACCCCCGAGATCTTCGACACGCAGTTCTTCATCGAGACCCAGCTCAAGGGC
ACGTCCTTCCCCGGCAAAGGCGCCAACCAGGGCGAGGTCCTCTCCCCGCTCCGCGGCGAGATGCGCCTCCAGTCCGACTTCCTGATCGCCCGCGACAACCGCACCGCGTGCGAGTGGCAG
TCGTTCACCAACGACCAGGAGAAGTTCCAGGAGACGTTCCCCGACGTCTTCGGCCGCCTCGCCGTCCTCGGTGTCGACAACAGCACCCTCATCGACTGCTCCGAGGTTCTCCCGGTGCCC
CCGCCCCTCCCGCGCAGCGCTGTCCCCCACTTCCCCGCCGGAAAGTCCATCCGCGACGTCGAGCCCGCT
TGCGCTGAGACTCCCTTCCCCACCTTCCCGACCGACCCCGGTCCGGCCACC
ACGATCGCTCGCGT
TCCCAACGTCTAA

Retrieve as FASTA