Entry information : SsteMnP03
Entry ID 12317
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-20 (Catherine Mathe (Scipio))
Peroxidase information: SsteMnP03
Name SsteMnP03
Class Manganese peroxidase    [Orthogroup: MnP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sphaerobolaceae Sphaerobolus
Organism Sphaerobolus stellatus    [TaxId: 68786 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsteMnP03
start..stop
S start..stop
SsteMnP20 686 0 1..376 1..376
SsteMnP15 667 0 1..376 1..376
RrubMnP07 632 0 1..370 1..371
RrubMnP01 620 0 1..365 1..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2484167..2484321 155 N° 2 2484373..2484425 53 N° 3 2484485..2485012 528 N° 4 2485065..2485158 94
N° 5 2485216..2485377 162 N° 6 2485433..2485534 102 N° 7 2485586..2485622 37  
join(2484167..2484321,2484373..2484425,2484485..2485012,2485065..2485158,2485216 ..2485377,2485433..2485534,2485586..2485622)


exon

Literature and cross-references SsteMnP03
DNA ref. JGI genome:   scaffold_2 (2484167..2485622)
Cluster/Prediction ref. JGI gene:   239584
Protein sequence: SsteMnP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377 (358)
PWM (Da):   %s   39638.7 (37752.6)  
PI (pH):   %s   4.51 (4.46) Peptide Signal:   %s   cut: 19 range:19-376
Sequence 418
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKALAVLATVATIVQAAPANHLVTCPDGNKASNAACCAFFALRDDLQANLFDNQCGEDTHEVVRLTFHDAIAFSTSLKFQGKPAGGGADGSMLVFPDVEPNFSANNGISDSVDALLPFLAKHPVSAGDLIQFAGAVGLTNCPGAPQLEFLAGRPNATAPAPDGLIPEPQDSVEKIFERFLDGGGFTPDEIIALLASHTIARADHVDPTLDAAPFDSTPFTFDTQVFLEVLLKGTGFPGLGNNTGEVMSPLPVTSDKDVGELRLQSDFALARHPVTACTWQGFVNEQEKMASAFKAAMAKLAVNGQDTRHFVDCSEVIPTPVPAVKKPATFPATKTRKDIEQACLFSPFPNLKTDAGPVETLIPHCPDGTMNCVS*

Retrieve as FASTA  
Remarks complete sequence from genomics (6 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCTTCAAAGCCCTTGCTGTCTTAGCCACCGTTGCAACCATCGTACAGGCTGCCCCTGCTAATCACCTTGTAACATGCCCCGATGGCAATAAGGCATCTAATGCTGCGTGTTGTGCCT
TCTTTGCTCTCCGTGACGATCTTCAGGCCAACCT
GTACGTTTTTAATCAAATTGTGTGATTTTCGTTTTTAACCGTACTTTGCAGGTTTGACAACCAATGTGGAGAGGACACCCACGAAG
TCGTTCGTCTCACTTTCC
GTAAGCATCTGTTGAGTTGCCAAGTTGCCAGGAATTTTTGCCTTAATTTGATCTTGTAGACGATGCTATTGCCTTCTCCACTTCCTTGAAATTTCAAGGCAA
GCCTGCCGGTGGGGGGGCTGATGGTTCCATGCTTGTTTTCCCCGACGTCGAACCCAACTTCTCGGCCAACAACGGTATTTCAGACAGTGTCGACGCTCTTCTTCCTTTCCTCGCTAAGCA
CCCCGTCTCTGCCGGCGATTTGATCCAATTCGCTGGTGCTGTCGGCCTCACTAATTGCCCAGGAGCACCACAACTCGAGTTTTTGGCTGGCCGTCCCAACGCTACCGCTCCCGCCCCTGA
TGGTCTCATTCCAGAGCCTCAAGACAGCGTTGAGAAAATATTTGAACGGTTCCTTGATGGAGGAGGATTTACTCCCGACGAGATCATTGCCTTACTGGCCTCCCATACCATCGCTCGTGC
TGACCATGTCGACCCCACTCTTGATGCTGCTCCTTTTGACAGCACCCCTTTTACCTTCGATACCCAGGTCTTCCTTGAAGTTTTGCTCAAGGGTACTGGCTTCCCAGGACTTGGAAACAA
TACCG
GTAATATTTAACATGAAATTCCACCCGCACTATATCTAACTATAATTTCTAGGTGAGGTTATGTCTCCTTTGCCGGTCACCAGTGACAAGGACGTCGGTGAGCTTCGTCTTCAAT
CTGACTTCGCTCTCGCGCGCCATCCCGTCAC
GTAGGTTTTTAGGTTAAATTATCAAATTATCCTCTCATCTTTAACCAATTAAAATAGTGCTTGCACATGGCAAGGCTTTGTCAACGAGC
AAGAAAAGATGGCCAGCGCTTTCAAGGCTGCCATGGCTAAGCTCGCGGTCAACGGTCAAGACACTCGTCACTTCGTCGATTGCTCTGAAGTCATTCCTACTCCTGTTCCTGCTGTTAAAA
AGCCGGCTAC
GTAAGTGCTATATTTCCGAAAAGGTCAGTACAACTAATCAATTTCTTATTATTAGGTTCCCTGCCACCAAGACCAGGAAGGATATCGAGCAGGCCTGCTTGTTCTCGCCG
TTCCCTAACCTCAAGACCGATGCTGGCCCAGTTGAGACTCTTATCCC
GTACGTTATGCCTTTAAGTTAAAGTGAAGGAGACTTATTAAATTTTCATAGCCATTGCCCCGATGGTACCATG
AACTGCGTCTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCTTCAAAGCCCTTGCTGTCTTAGCCACCGTTGCAACCATCGTACAGGCTGCCCCTGCTAATCACCTTGTAACATGCCCCGATGGCAATAAGGCATCTAATGCTGCGTGTTGTGCCT
TCTTTGCTCTCCGTGACGATCTTCAGGCCAACCT
GTTTGACAACCAATGTGGAGAGGACACCCACGAAGTCGTTCGTCTCACTTTCCACGATGCTATTGCCTTCTCCACTTCCTTGAAAT
TTCAAGGCAAGCCTGCCGGTGGGGGGGCTGATGGTTCCATGCTTGTTTTCCCCGACGTCGAACCCAACTTCTCGGCCAACAACGGTATTTCAGACAGTGTCGACGCTCTTCTTCCTTTCC
TCGCTAAGCACCCCGTCTCTGCCGGCGATTTGATCCAATTCGCTGGTGCTGTCGGCCTCACTAATTGCCCAGGAGCACCACAACTCGAGTTTTTGGCTGGCCGTCCCAACGCTACCGCTC
CCGCCCCTGATGGTCTCATTCCAGAGCCTCAAGACAGCGTTGAGAAAATATTTGAACGGTTCCTTGATGGAGGAGGATTTACTCCCGACGAGATCATTGCCTTACTGGCCTCCCATACCA
TCGCTCGTGCTGACCATGTCGACCCCACTCTTGATGCTGCTCCTTTTGACAGCACCCCTTTTACCTTCGATACCCAGGTCTTCCTTGAAGTTTTGCTCAAGGGTACTGGCTTCCCAGGAC
TTGGAAACAATACCG
GTGAGGTTATGTCTCCTTTGCCGGTCACCAGTGACAAGGACGTCGGTGAGCTTCGTCTTCAATCTGACTTCGCTCTCGCGCGCCATCCCGTCACTGCTTGCACAT
GGCAAGGCTTTGTCAACGAGCAAGAAAAGATGGCCAGCGCTTTCAAGGCTGCCATGGCTAAGCTCGCGGTCAACGGTCAAGACACTCGTCACTTCGTCGATTGCTCTGAAGTCATTCCTA
CTCCTGTTCCTGCTGTTAAAAAGCCGGCTAC
GTTCCCTGCCACCAAGACCAGGAAGGATATCGAGCAGGCCTGCTTGTTCTCGCCGTTCCCTAACCTCAAGACCGATGCTGGCCCAGTTG
AGACTCTTATCCC
CCATTGCCCCGATGGTACCATGAACTGCGTCTCTTAA

Retrieve as FASTA