Entry information : SsteMnP10
Entry ID 12324
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2017-04-20 (Catherine Mathe (Scipio))
Peroxidase information: SsteMnP10
Name SsteMnP10
Class Manganese peroxidase     [Orthogroup: MnP002]*
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sphaerobolaceae Sphaerobolus
Organism Sphaerobolus stellatus    [TaxId: 68786 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsteMnP10
start..stop
S start..stop
RrubMnP03 345 6e-120 10..228 156..375
RrubMnP11 341 2e-118 10..228 157..376
RrubMnP02 338 6e-117 10..221 156..368
SsteMnP17 335 1e-115 10..228 157..376
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 679689..679717 29 N° 2 679051..679416 366 N° 3 678834..678995 162 N° 4 678683..678781 99
N° 5 678567..678627 61  
complement(join(678567..678627,678683..678781,678834..678995,679051..679416,6796 89..679717))


exon

Literature and cross-references SsteMnP10
DNA ref. JGI genome:   scaffold_32 (679717..678567)
Cluster/Prediction ref. JGI gene:   250084
Protein sequence: SsteMnP10
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   239
PWM (Da):   %s   25440.87  
PI (pH):   %s   4.89
Sequence 281
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQQKALPSFRLRTRTPAPDGLIPEPSDDVTKILARFSDAGGFTPDEVVALLASHTIARSDKVDPTISAVPFDSTPFTFDSQVFLEVLLKGVGFPGTGNNSGEVEFPLPVGQGLNVGEMRLQSDFALARDARTACTWQGFINEQEKMANAFQAAMAKLAVVGQDSSKFIDCSEVVPIPVPAVRKPTTFPATKTKKDIQQACPLPFPNLATDPGAHETIIPHCISTDKACLATETGAPSSS*

Retrieve as FASTA  
Remarks incorrect prediction from genomics (4 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCAGAAAGCTCTTCCAAGTTTTCGGTATGTATAAGCCGTTCTGGCAGAGTAGACGGTTATATCTCAAGGTTCCTGTATAAAAATAGTCGGGAGGGTGATTTTTCTTGAAGACACA
TTTCCGAGATGCCGGGTTTCTACAAAGCCGCCAGTGTCAATTGCATGTCTGGGAATGTTTAAACGAAAATCATCTGAGAGCATGTTTTCTAATTTATCTGGTTCTATGCGGGTTTTATTC
ACTTGGAACTCATCAGTTTCTCAAGGGATTTGACAAGTTAAGCAAACACTGTGACCTACAGGCTCAGGACTAGGACTCCCGCTCCGGACGGTTTGATTCCTGAGCCATCAGATGACGTCA
CAAAAATTCTGGCACGCTTTAGCGACGCTGGAGGCTTCACCCCCGACGAAGTCGTCGCATTGCTTGCTTCGCACACGATCGCAAGGTCCGACAAGGTTGACCCGACCATCTCGGCTGTCC
CGTTCGACTCCACGCCGTTCACTTTCGACAGTCAGGTTTTCCTCGAAGTCTTGTTGAAGGGTGTTGGCTTCCCTGGAACTGGAAACAACAGTGGCGAAGTTGAATTCCCTCTTCCTGTTG
GTCAAGGCCTCAATGTCGGTGAAATGCGTCTCCAATCCGACTTTGCCCTGGCCCGTGACGCTCGCAC
GTGAGTAAAATTCGGAAAGTATTATTGGCCTATATTGATCCTGAAAATATAAT
AGAGCATGCACCTGGCAAGGCTTCATTAACGAACAGGAGAAGATGGCCAACGCCTTCCAGGCTGCCATGGCGAAGCTTGCTGTTGTCGGTCAAGACAGCTCCAAGTTTATTGATTGCTCT
GAAGTCGTCCCCATTCCGGTCCCTGCTGTAAGAAAACCCACTAC
GTGAGTAATTTTAGAAGAAACGAGGGATGTATCGTACTCACAAGTTATACAGCTTCCCTGCCACCAAGACCAAGAA
GGACATTCAACAGGCCTGCCCTCTTCCATTCCCCAACCTTGCCACTGACCCCGGTGCACACGAGACTATTATTCC
GTAAGTTATAATTAATGCATTAGTAATGAGAAATTACTCACTGTC
ATTATACTAGCCACTGCATCTCCACAGACAAGGCTTGTCTTGCGACTGAAACCGGAGCGCCGAGTTCCTC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCAGAAAGCTCTTCCAAGTTTTCGGCTCAGGACTAGGACTCCCGCTCCGGACGGTTTGATTCCTGAGCCATCAGATGACGTCACAAAAATTCTGGCACGCTTTAGCGACGCTGGA
GGCTTCACCCCCGACGAAGTCGTCGCATTGCTTGCTTCGCACACGATCGCAAGGTCCGACAAGGTTGACCCGACCATCTCGGCTGTCCCGTTCGACTCCACGCCGTTCACTTTCGACAGT
CAGGTTTTCCTCGAAGTCTTGTTGAAGGGTGTTGGCTTCCCTGGAACTGGAAACAACAGTGGCGAAGTTGAATTCCCTCTTCCTGTTGGTCAAGGCCTCAATGTCGGTGAAATGCGTCTC
CAATCCGACTTTGCCCTGGCCCGTGACGCTCGCAC
AGCATGCACCTGGCAAGGCTTCATTAACGAACAGGAGAAGATGGCCAACGCCTTCCAGGCTGCCATGGCGAAGCTTGCTGTTGTC
GGTCAAGACAGCTCCAAGTTTATTGATTGCTCTGAAGTCGTCCCCATTCCGGTCCCTGCTGTAAGAAAACCCACTAC
CTTCCCTGCCACCAAGACCAAGAAGGACATTCAACAGGCCTGC
CCTCTTCCATTCCCCAACCTTGCCACTGACCCCGGTGCACACGAGACTATTATTCC
CCACTGCATCTCCACAGACAAGGCTTGTCTTGCGACTGAAACCGGAGCGCCGAGTTCCTC

Retrieve as FASTA