Entry information : SsteMnP16
Entry ID 12335
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-20 (Catherine Mathe (Scipio))
Peroxidase information: SsteMnP16
Name SsteMnP16
Class Manganese peroxidase    [Orthogroup: MnP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sphaerobolaceae Sphaerobolus
Organism Sphaerobolus stellatus    [TaxId: 68786 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsteMnP16
start..stop
S start..stop
SsteMnP19 755 0 1..380 1..380
SsteMnP23-3 692 0 1..380 1..380
SsteMnP23-1 692 0 1..380 1..380
SsteMnP23-2 691 0 1..380 1..380
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 572621..572778 158 N° 2 572514..572566 53 N° 3 571927..572457 531 N° 4 571795..571878 84
N° 5 571571..571742 172 N° 6 571413..571514 102 N° 7 571320..571359 40  
complement(join(571320..571359,571413..571514,571571..571742,571795..571878,5719 27..572457,572514..572566,572621..572778))


exon

Literature and cross-references SsteMnP16
DNA ref. JGI genome:   scaffold_15 (572778..571320)
Cluster/Prediction ref. JGI gene:   159860
Protein sequence: SsteMnP16
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   381 (361)
PWM (Da):   %s   39403.16 (37433.2)  
PI (pH):   %s   4.07 (4.07) Peptide Signal:   %s   cut: 20 range:20-380
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFASLISFVGFSVAAVQAANFRRVTCPDGVNTATNAACCAFFALRDDLQTHLFDNQCGEDAHEVVRLSFHDAIAFSSSLKAQGKPAGGGADGSMLVFPDVEPNFSANNGISDSVNALLPFLAAHNTISAGDLIQFAGAVGISNCPGAPRLQFLAGRPNATAPAPDGLIPEPQDTVTDILARFEDGGGFSSDEVVALLASHSIARADHVDPKLNAAPFDSTPFDFDTQIFVEVLLRGVGFPGTGGNQGEAESPLPLTNGEDVGELRLLSDQTIARDSRTACTWQGFVNQQEKMASAFQAAMAKLAVVGQDVSSLIDCSEVVPIPVPSSGKPATFPATKTIADIEQACANAPFPSLASDPGTVETLIPHCPDGSEDDCDSS*

Retrieve as FASTA  
Remarks complete sequence from genomics (6 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTGCATCCCTCATCTCGTTCGTCGGTTTCTCTGTCGCGGCTGTTCAAGCAGCGAATTTCAGGCGCGTTACCTGCCCCGATGGCGTTAACACCGCTACCAACGCTGCCTGCTGT
GCTTTCTTCGCTCTCCGTGATGACCTTCAGACCCATTT
GTACGTCCATTAAAACGATAGATGCAACTTCGAATTTATTAAATTTATTTCCAGGTTCGACAACCAATGTGGTGAAGATGCT
CATGAAGTCGTCCGGTTGAGTTTCC
GTCAGCATTTTAACCTGTAATTTATTTTCACCAAACGCTAATATTTGATCCTTCAGACGACGCTATTGCGTTCTCCTCTTCCCTGAAGGCCCAAG
GAAAGCCTGCTGGTGGAGGAGCAGATGGCTCCATGCTCGTTTTTCCAGATGTTGAGCCTAACTTCAGTGCAAACAACGGTATCTCCGATTCTGTCAATGCTCTGTTGCCATTCCTCGCAG
CACACAACACCATCAGCGCTGGCGATCTTATCCAATTCGCAGGGGCTGTTGGAATCAGCAACTGTCCTGGAGCTCCTCGGTTGCAGTTCTTGGCTGGTCGTCCTAACGCGACTGCTCCCG
CCCCTGATGGTCTTATTCCAGAGCCGCAAGACACTGTCACAGATATTCTCGCTCGCTTTGAAGACGGTGGAGGATTCAGCTCCGACGAAGTCGTTGCGTTGCTTGCATCACACTCGATTG
CTCGTGCAGACCATGTTGACCCGAAATTGAATGCTGCTCCTTTTGACAGCACTCCGTTTGACTTTGATACTCAAATATTCGTTGAAGTCTTGCTCAGAGGTGTTGGGTTCCCCGGAACTG
GAGGCAACCAAG
GTAAGTATCATCTCAGTGTCAGTGTGATAATCTAACTCTTCTGACTAGGTGAAGCCGAGTCTCCTTTGCCGCTAACGAATGGCGAAGATGTCGGTGAACTTCGTCTCC
TATCTGATCAGACAATCGCACGGG
GTAAGTCTACACTCCACACCGAGAAATACTTGTATTCACAATTAGACGATAGACTCGAGGACTGCATGCACCTGGCAAGGGTTCGTGAACCAGCAA
GAGAAGATGGCCAGTGCTTTCCAAGCTGCCATGGCCAAGCTCGCCGTTGTCGGTCAAGATGTGTCCTCGTTGATTGACTGCTCTGAGGTCGTTCCTATCCCAGTTCCTTCCTCTGGAAAG
CCTGCGAC
GTGAGTATAAATAATTAATATTAAGATAACATACTAATCGCCCTCGTGCAACGTAGATTCCCTGCTACCAAAACTATTGCAGATATTGAGCAGGCATGTGCTAATGCGCCGT
TCCCTAGCCTTGCCTCCGATCCTGGTACAGTAGAGACCTTGATTCC
GTCAGTGTTATATTGAACTAAACGATCGGGAATTCGCTAATACGATTTTCTAGTCATTGCCCTGACGGTTCAGA
GGACGACTGCGACTCCAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTGCATCCCTCATCTCGTTCGTCGGTTTCTCTGTCGCGGCTGTTCAAGCAGCGAATTTCAGGCGCGTTACCTGCCCCGATGGCGTTAACACCGCTACCAACGCTGCCTGCTGT
GCTTTCTTCGCTCTCCGTGATGACCTTCAGACCCATTT
GTTCGACAACCAATGTGGTGAAGATGCTCATGAAGTCGTCCGGTTGAGTTTCCACGACGCTATTGCGTTCTCCTCTTCCCTG
AAGGCCCAAGGAAAGCCTGCTGGTGGAGGAGCAGATGGCTCCATGCTCGTTTTTCCAGATGTTGAGCCTAACTTCAGTGCAAACAACGGTATCTCCGATTCTGTCAATGCTCTGTTGCCA
TTCCTCGCAGCACACAACACCATCAGCGCTGGCGATCTTATCCAATTCGCAGGGGCTGTTGGAATCAGCAACTGTCCTGGAGCTCCTCGGTTGCAGTTCTTGGCTGGTCGTCCTAACGCG
ACTGCTCCCGCCCCTGATGGTCTTATTCCAGAGCCGCAAGACACTGTCACAGATATTCTCGCTCGCTTTGAAGACGGTGGAGGATTCAGCTCCGACGAAGTCGTTGCGTTGCTTGCATCA
CACTCGATTGCTCGTGCAGACCATGTTGACCCGAAATTGAATGCTGCTCCTTTTGACAGCACTCCGTTTGACTTTGATACTCAAATATTCGTTGAAGTCTTGCTCAGAGGTGTTGGGTTC
CCCGGAACTGGAGGCAACCAAG
GTGAAGCCGAGTCTCCTTTGCCGCTAACGAATGGCGAAGATGTCGGTGAACTTCGTCTCCTATCTGATCAGACAATCGCACGGGACTCGAGGACTGCA
TGCACCTGGCAAGGGTTCGTGAACCAGCAAGAGAAGATGGCCAGTGCTTTCCAAGCTGCCATGGCCAAGCTCGCCGTTGTCGGTCAAGATGTGTCCTCGTTGATTGACTGCTCTGAGGTC
GTTCCTATCCCAGTTCCTTCCTCTGGAAAGCCTGCGAC
ATTCCCTGCTACCAAAACTATTGCAGATATTGAGCAGGCATGTGCTAATGCGCCGTTCCCTAGCCTTGCCTCCGATCCTGGT
ACAGTAGAGACCTTGATTCC
TCATTGCCCTGACGGTTCAGAGGACGACTGCGACTCCAGT

Retrieve as FASTA