Entry information : SsteMnP17
Entry ID 12336
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-20 (Catherine Mathe (Scipio))
Peroxidase information: SsteMnP17
Name SsteMnP17
Class Manganese peroxidase    [Orthogroup: MnP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sphaerobolaceae Sphaerobolus
Organism Sphaerobolus stellatus    [TaxId: 68786 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsteMnP17
start..stop
S start..stop
RrubMnP11 671 0 1..376 1..376
SsteMnP16 654 0 1..379 1..380
SsteMnP23-2 653 0 1..379 1..380
SsteMnP23-1 652 0 1..379 1..380
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1942792..1942949 158 N° 2 1943002..1943054 53 N° 3 1943114..1943644 531 N° 4 1943696..1943779 84
N° 5 1943833..1944004 172 N° 6 1944061..1944162 102 N° 7 1944220..1944256 37  
join(1942792..1942949,1943002..1943054,1943114..1943644,1943696..1943779,1943833 ..1944004,1944061..1944162,1944220..1944256)


exon

Literature and cross-references SsteMnP17
DNA ref. JGI genome:   scaffold_4 (1942792..1944256)
Cluster/Prediction ref. JGI gene:   152564
Protein sequence: SsteMnP17
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   380 (360)
PWM (Da):   %s   39517.45 (37581.4)  
PI (pH):   %s   4.16 (4.16) Peptide Signal:   %s   cut: 20 range:20-379
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFASLISFVGLSVAAVQAANFKRVACPDGKNTATNAVCCDFFALRDDLQANLFDNQCGEDTHEVVRLTFHDAIAFSESLKSQGKPAGGGADGSMLIFPNVEPNFSANLGISDSVDALLPFLAKHNTISAGDLIQFAGAVGISNCPGAPRLEFLAGRPNATAPAPDGLIPEPQDSVDTIISRFADGGGFTPEEIIALLSSHSIARADHVDPTLNAAPFDSTPFTFDTQIFVEVLLKGVGFPGIANNTGEVESPLPLTQGEDVGELRLQSDFALARDPRTACTWQGFVNEQEKMASAFQAAMAKLAVVAQDTSKLIDCSEVIPEPVPASGKPATFPATKTKADIQQACAASPFPSLASDPGSVETLIPHCPDGETSCDSS*

Retrieve as FASTA  
Remarks complete sequence from genomics (6 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTGCATCTCTCATCTCCTTCGTCGGTCTCTCTGTCGCAGCCGTTCAGGCAGCCAACTTCAAGCGCGTTGCCTGCCCCGATGGCAAGAACACTGCTACCAACGCTGTCTGTTGT
GACTTCTTCGCTCTGCGCGATGACCTCCAGGCCAACTT
GTATGTTGAACATACATGCGGGGGTGACAGCATTAATCCAGTAATTCTCTAGGTTCGATAACCAGTGCGGTGAAGATACCCA
TGAAGTCGTTCGCTTGACTTTCC
GTAAGGACTAGGGCATCCTGCATTGAACAGCTGCATTTCTCTAACCGTTAAATCTCTAGATGACGCTATCGCCTTCTCAGAGTCCCTTAAAAGCCAG
GGCAAGCCTGCCGGTGGAGGAGCAGACGGCTCCATGCTTATTTTCCCGAACGTCGAGCCCAACTTCTCCGCCAACCTCGGTATCTCTGATTCTGTCGATGCGCTTCTTCCTTTCCTGGCC
AAGCACAACACTATCTCTGCTGGTGACCTCATCCAGTTCGCAGGCGCTGTTGGAATTAGCAACTGTCCTGGAGCCCCTCGATTGGAGTTCTTGGCTGGTCGTCCCAACGCGACTGCCCCC
GCTCCCGATGGCCTTATCCCGGAACCACAGGACTCTGTGGACACCATTATCTCCCGTTTTGCCGACGGTGGAGGATTTACTCCAGAGGAAATTATTGCCTTGCTCTCATCCCACTCGATT
GCTCGCGCTGACCATGTTGACCCAACTTTGAACGCGGCTCCTTTCGATTCCACTCCTTTCACTTTTGACACCCAAATCTTCGTCGAGGTCTTGCTCAAGGGAGTTGGCTTCCCCGGAATC
GCAAACAACACTG
GTAAGTGATTTATATTTAAACTGTAATATTAAAATACTCACTACTAAACAGGTGAAGTCGAATCTCCTCTTCCATTGACTCAGGGTGAAGATGTTGGTGAACTTCGT
CTCCAATCCGATTTCGCACTTGCTCGCG
GTCCGTGAAGCTCATCTGTTAAAAAAACTCTCATCATTGATATTCTATAACAGACCCAAGGACTGCATGCACCTGGCAAGGGTTCGTTAACG
AGCAGGAAAAAATGGCTAGTGCCTTCCAGGCTGCCATGGCCAAGCTCGCTGTTGTCGCCCAAGACACGTCCAAGTTAATTGACTGCTCAGAAGTCATTCCTGAGCCTGTTCCGGCCTCAG
GAAAACCTGCAAC
GTGAGTATTATACATCATAATACTTTTAATTATTTACTAATTCATTTGGGCCTTAGTTTCCCTGCTACTAAGACCAAGGCAGATATTCAGCAAGCTTGCGCTGCTTC
CCCATTCCCTAGCCTTGCGTCCGACCCCGGCTCAGTGGAGACATTAATTCC
GTGAGTAATTAATCCTCAATAGCAATTATAGTACTCTGACGATAAATGAATTTATAGCCACTGCCCTGA
CGGTGAAACCAGCTGCGACTCCAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTGCATCTCTCATCTCCTTCGTCGGTCTCTCTGTCGCAGCCGTTCAGGCAGCCAACTTCAAGCGCGTTGCCTGCCCCGATGGCAAGAACACTGCTACCAACGCTGTCTGTTGT
GACTTCTTCGCTCTGCGCGATGACCTCCAGGCCAACTT
GTTCGATAACCAGTGCGGTGAAGATACCCATGAAGTCGTTCGCTTGACTTTCCATGACGCTATCGCCTTCTCAGAGTCCCTT
AAAAGCCAGGGCAAGCCTGCCGGTGGAGGAGCAGACGGCTCCATGCTTATTTTCCCGAACGTCGAGCCCAACTTCTCCGCCAACCTCGGTATCTCTGATTCTGTCGATGCGCTTCTTCCT
TTCCTGGCCAAGCACAACACTATCTCTGCTGGTGACCTCATCCAGTTCGCAGGCGCTGTTGGAATTAGCAACTGTCCTGGAGCCCCTCGATTGGAGTTCTTGGCTGGTCGTCCCAACGCG
ACTGCCCCCGCTCCCGATGGCCTTATCCCGGAACCACAGGACTCTGTGGACACCATTATCTCCCGTTTTGCCGACGGTGGAGGATTTACTCCAGAGGAAATTATTGCCTTGCTCTCATCC
CACTCGATTGCTCGCGCTGACCATGTTGACCCAACTTTGAACGCGGCTCCTTTCGATTCCACTCCTTTCACTTTTGACACCCAAATCTTCGTCGAGGTCTTGCTCAAGGGAGTTGGCTTC
CCCGGAATCGCAAACAACACTG
GTGAAGTCGAATCTCCTCTTCCATTGACTCAGGGTGAAGATGTTGGTGAACTTCGTCTCCAATCCGATTTCGCACTTGCTCGCGACCCAAGGACTGCA
TGCACCTGGCAAGGGTTCGTTAACGAGCAGGAAAAAATGGCTAGTGCCTTCCAGGCTGCCATGGCCAAGCTCGCTGTTGTCGCCCAAGACACGTCCAAGTTAATTGACTGCTCAGAAGTC
ATTCCTGAGCCTGTTCCGGCCTCAGGAAAACCTGCAAC
TTTCCCTGCTACTAAGACCAAGGCAGATATTCAGCAAGCTTGCGCTGCTTCCCCATTCCCTAGCCTTGCGTCCGACCCCGGC
TCAGTGGAGACATTAATTCC
CCACTGCCCTGACGGTGAAACCAGCTGCGACTCCAGT

Retrieve as FASTA