Entry information : SsteMnP18
Entry ID 12337
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-20 (Catherine Mathe (Scipio))
Peroxidase information: SsteMnP18
Name SsteMnP18
Class Manganese peroxidase    [Orthogroup: MnP004]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sphaerobolaceae Sphaerobolus
Organism Sphaerobolus stellatus    [TaxId: 68786 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsteMnP18
start..stop
S start..stop
SsteMnP13 716 0 1..374 1..373
SsteMnP22 679 0 1..374 1..373
SsteMnP05 660 0 1..374 1..376
SsteMnP12 657 0 1..374 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 650880..651055 176 N° 2 651111..651163 53 N° 3 651214..651744 531 N° 4 651801..651894 94
N° 5 651945..652109 165 N° 6 652169..652271 103  
join(650880..651055,651111..651163,651214..651744,651801..651894,651945..652109, 652169..652271)


exon

Literature and cross-references SsteMnP18
DNA ref. JGI genome:   scaffold_66 (650880..652271)
Cluster/Prediction ref. JGI gene:   173226
Protein sequence: SsteMnP18
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   375 (356)
PWM (Da):   %s   39115.79 (37254.7)  
PI (pH):   %s   4.61 (4.54) Peptide Signal:   %s   cut: 19 range:19-374
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKAVAIFASLASLVVAVPQASPDVATTKSITCPDGTIVPNSACCPFIALREDLLANLFQGVCGEDAHQAVRLIFHDSIGFSQEMHAKGIFSGGGADGSVLVFPDVEANRAENAGIADGVNGQLPFLSRHPTVTAADLVQFAAAVGITNCPGSPRLKFFTGRPNATAPPPEGLVPNPADSVTKILARFDDAGNIQPAEVVALLASHSIANADHVDPDIQAVPFDSTQNTFDTQLFLEVLLKGIGFPGSANNSGEVSSPLPIGTTAQPGELRLQSDFALARDPRTACVWQSFINNQELMQNAFVEAVDKMSRIGLAHPENLIDCSVVVPQPVAKVTKPATYPATKSFKDIQRACFAAPFPSLASDPGATETLVA*

Retrieve as FASTA  
Remarks complete sequence from genomics(5 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAAGCAGTAGCCATTTTCGCCTCCCTCGCCTCCCTCGTCGTCGCAGTACCTCAGGCTTCCCCTGACGTCGCGACCACAAAGAGCATAACCTGCCCCGATGGAACTATAGTC
CCCAATTCAGCTTGCTGCCCTTTCATCGCTTTGCGCGAGGACCTGCTGGCGAACCT
GTGCGACCTGCTTTCCTGTTACGTTGTTCTTGCTCTAATTTATTCTGTTTTACAGGTTCCAAGG
TGTTTGTGGCGAAGATGCTCACCAGGCCGTCCGTCTCATTTTCC
GTACGTCCCCGAACCCATTTGAAGTCTTCATATCACTTATTCCCTTGCAGACGACTCGATTGGCTTCTCCCAAGAG
ATGCACGCTAAAGGCATCTTCTCCGGTGGAGGAGCCGACGGTTCAGTGCTAGTCTTCCCCGATGTTGAGGCGAATCGTGCAGAAAATGCCGGTATCGCAGATGGTGTCAATGGTCAACTT
CCCTTCTTGTCAAGGCACCCGACGGTTACCGCTGCCGATCTTGTCCAATTCGCCGCTGCCGTCGGTATCACCAACTGCCCTGGTTCACCCAGGCTGAAATTCTTCACTGGTCGTCCAAAT
GCCACCGCACCTCCTCCTGAAGGTCTCGTCCCCAACCCCGCAGACTCGGTCACTAAGATTCTCGCACGTTTCGACGATGCCGGTAACATCCAGCCCGCCGAGGTCGTCGCATTACTGGCT
TCTCATAGTATCGCCAATGCCGATCACGTCGACCCAGATATCCAAGCTGTTCCTTTCGACAGCACTCAGAACACCTTCGACACTCAACTCTTCCTTGAGGTCTTGCTTAAGGGTATCGGC
TTCCCTGGATCCGCTAACAACAGTG
GTAAGTTTTATTATTTAGATGTGTGCAGTGTCTGAACTCATCTTTTTGGTTTATAGGCGAAGTCTCATCTCCTCTTCCCATCGGCACCACGGCTC
AGCCAGGTGAACTGCGTCTCCAATCTGACTTTGCTCTCGCTCGGGACCCACGAAC
GTAAGTGTCATCCATTTTGAAAATTAATTTGACTCTGAAAAATGTTGCAGCGCCTGTGTTTGGCA
AAGCTTCATCAACAACCAAGAACTGATGCAGAATGCCTTCGTTGAGGCCGTCGACAAGATGTCTAGAATTGGATTGGCACACCCCGAAAATCTTATTGATTGCTCGGTAGTTGTTCCCCA
GCCGGTTGCCAAGGTTACGAAGCCCGCCAC
GTGAGTTCTTTTCAGTGTTTTCTGTCTCTTTCAAATGAGTATTCATGTTTTGTTTCTAGATACCCCGCGACGAAATCTTTCAAAGATATT
CAACGGGCTTGCTTCGCGGCTCCTTTCCCGAGTCTCGCTTCCGATCCAGGTGCCACTGAAACCCTCGTCGCG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAAGCAGTAGCCATTTTCGCCTCCCTCGCCTCCCTCGTCGTCGCAGTACCTCAGGCTTCCCCTGACGTCGCGACCACAAAGAGCATAACCTGCCCCGATGGAACTATAGTC
CCCAATTCAGCTTGCTGCCCTTTCATCGCTTTGCGCGAGGACCTGCTGGCGAACCT
GTTCCAAGGTGTTTGTGGCGAAGATGCTCACCAGGCCGTCCGTCTCATTTTCCACGACTCGATT
GGCTTCTCCCAAGAGATGCACGCTAAAGGCATCTTCTCCGGTGGAGGAGCCGACGGTTCAGTGCTAGTCTTCCCCGATGTTGAGGCGAATCGTGCAGAAAATGCCGGTATCGCAGATGGT
GTCAATGGTCAACTTCCCTTCTTGTCAAGGCACCCGACGGTTACCGCTGCCGATCTTGTCCAATTCGCCGCTGCCGTCGGTATCACCAACTGCCCTGGTTCACCCAGGCTGAAATTCTTC
ACTGGTCGTCCAAATGCCACCGCACCTCCTCCTGAAGGTCTCGTCCCCAACCCCGCAGACTCGGTCACTAAGATTCTCGCACGTTTCGACGATGCCGGTAACATCCAGCCCGCCGAGGTC
GTCGCATTACTGGCTTCTCATAGTATCGCCAATGCCGATCACGTCGACCCAGATATCCAAGCTGTTCCTTTCGACAGCACTCAGAACACCTTCGACACTCAACTCTTCCTTGAGGTCTTG
CTTAAGGGTATCGGCTTCCCTGGATCCGCTAACAACAGTG
GCGAAGTCTCATCTCCTCTTCCCATCGGCACCACGGCTCAGCCAGGTGAACTGCGTCTCCAATCTGACTTTGCTCTCGCT
CGGGACCCACGAAC
CGCCTGTGTTTGGCAAAGCTTCATCAACAACCAAGAACTGATGCAGAATGCCTTCGTTGAGGCCGTCGACAAGATGTCTAGAATTGGATTGGCACACCCCGAAAAT
CTTATTGATTGCTCGGTAGTTGTTCCCCAGCCGGTTGCCAAGGTTACGAAGCCCGCCAC
ATACCCCGCGACGAAATCTTTCAAAGATATTCAACGGGCTTGCTTCGCGGCTCCTTTCCCG
AGTCTCGCTTCCGATCCAGGTGCCACTGAAACCCTCGTCGCG

Retrieve as FASTA