Entry information : SsteMnP19
Entry ID 12338
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-20 (Catherine Mathe (Scipio))
Peroxidase information: SsteMnP19
Name SsteMnP19
Class Manganese peroxidase    [Orthogroup: MnP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sphaerobolaceae Sphaerobolus
Organism Sphaerobolus stellatus    [TaxId: 68786 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsteMnP19
start..stop
S start..stop
SsteMnP16 755 0 1..380 1..380
SsteMnP23-3 687 0 1..380 1..380
SsteMnP23-1 687 0 1..380 1..380
SsteMnP23-2 686 0 1..380 1..380
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 834265..834422 158 N° 2 834158..834210 53 N° 3 833571..834101 531 N° 4 833439..833522 84
N° 5 833215..833386 172 N° 6 833057..833158 102 N° 7 832964..833003 40  
complement(join(832964..833003,833057..833158,833215..833386,833439..833522,8335 71..834101,834158..834210,834265..834422))


exon

Literature and cross-references SsteMnP19
DNA ref. JGI genome:   scaffold_29 (834422..832964)
Cluster/Prediction ref. JGI gene:   164436
Protein sequence: SsteMnP19
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   380 (361)
PWM (Da):   %s   39513.21 (37509.2)  
PI (pH):   %s   4.11 (4.11) Peptide Signal:   %s   cut: 20 range:20-380
Sequence 422
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFASFISFVGFSVAAVQAANFRRVTCPDGVNTATNAACCAFFALRDDLQTHLFDNQCGEDAHEVVRLSFHDAIAFSSSLKAQGKPAGGGADGSMLVFPDVEPNFSANNGISDSVNALLPFLAAHNTITAGDLIQFAGAVGISNCPGAPRLQFLAGRPNATAPAPDGLIPEPQDTVTDILARFEDGGGFSSDEVVALLASHSIARADHVDPKFKAAPFDSTPFDFDTQIFVEVLLRGVGFPGTGGNQGEAESPLPLTNGEDVGELRLLSDQTIARDSRTACTWQGFVNQQEKMASAFQAAMAKLAVVGQDVSSLIDCSEVVPIPVPSSGKPATFPATKTIADIEQACANAPFPSLASDPGTIETLIPHCPDGSEDDCDSS*

Retrieve as FASTA  
Remarks complete from genomics (6 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTGCATCCTTCATTTCGTTCGTCGGTTTCTCTGTCGCGGCTGTTCAAGCAGCGAACTTCAGGCGCGTTACCTGCCCCGATGGCGTTAACACCGCTACCAACGCTGCTTGCTGT
GCTTTCTTCGCTCTCCGTGATGACCTTCAGACCCATTT
GTACGTCCATTAAAATGATAGATGTAACTCCGAATTTATCAAATTTATTTCCAGGTTCGACAACCAGTGTGGCGAAGATGCT
CATGAAGTTGTCCGCTTGAGTTTCC
GTTAGCATTTTAACCTGTAATTGATTTTCACCAAAGGCTAATAGTTGATCCTTCAGACGACGCTATTGCGTTTTCCTCTTCCCTGAAGGCCCAAG
GAAAGCCTGCTGGTGGAGGAGCAGATGGCTCCATGCTCGTTTTTCCAGACGTTGAGCCTAACTTCAGTGCAAACAACGGTATCTCCGATTCTGTCAATGCTCTGTTGCCATTCCTCGCAG
CACACAATACCATCACCGCTGGCGATCTTATCCAATTCGCAGGGGCTGTTGGAATCAGCAACTGTCCTGGAGCTCCTCGGTTGCAGTTCTTGGCTGGTCGTCCTAACGCGACTGCTCCCG
CCCCTGATGGTCTTATTCCAGAGCCGCAAGACACTGTCACAGATATTCTCGCTCGCTTTGAAGACGGTGGAGGATTCAGCTCCGACGAAGTCGTTGCGTTGCTTGCATCACATTCGATTG
CTCGTGCAGACCATGTTGACCCGAAGTTCAAAGCTGCTCCTTTTGACAGCACTCCGTTTGATTTCGATACTCAAATCTTCGTTGAGGTCTTGCTCAGAGGTGTTGGGTTCCCCGGAACTG
GAGGTAACCAAG
GTAAGTATCATCTCAGTGTCAGTGTGATAATTTAACTCTTTTGACTAGGTGAAGCCGAGTCTCCTTTGCCACTAACAAATGGTGAAGATGTCGGTGAACTTCGTCTCC
TATCTGATCAGACAATCGCACGTG
GTAAGTCTACATTACACACCGAGAAATACTTGTATTCACAATTAGACGATAGACTCAAGGACTGCATGCACGTGGCAAGGGTTCGTGAACCAGCAA
GAGAAGATGGCCAGTGCTTTCCAAGCTGCCATGGCCAAGCTCGCCGTTGTCGGTCAGGATGTGTCCTCGTTGATTGACTGCTCTGAGGTCGTTCCTATCCCAGTTCCTTCCTCTGGAAAG
CCTGCGAC
GTGAGTTTAAATAATTAATATTAAGATAACATACTAATCGTCCTCGTGCAACGTAGATTCCCTGCTACCAAAACTATTGCAGATATTGAGCAGGCATGTGCTAATGCGCCGT
TCCCCAGCCTTGCCTCCGATCCTGGTACAATAGAGACCTTGATTCC
GTCAGTGTTAGATTGAACTAAACGATCGGGAATTCGCTAATACGATTTTCTAGTCATTGCCCTGACGGTTCAGA
GGACGACTGCGACTCCAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTGCATCCTTCATTTCGTTCGTCGGTTTCTCTGTCGCGGCTGTTCAAGCAGCGAACTTCAGGCGCGTTACCTGCCCCGATGGCGTTAACACCGCTACCAACGCTGCTTGCTGT
GCTTTCTTCGCTCTCCGTGATGACCTTCAGACCCATTT
GTTCGACAACCAGTGTGGCGAAGATGCTCATGAAGTTGTCCGCTTGAGTTTCCACGACGCTATTGCGTTTTCCTCTTCCCTG
AAGGCCCAAGGAAAGCCTGCTGGTGGAGGAGCAGATGGCTCCATGCTCGTTTTTCCAGACGTTGAGCCTAACTTCAGTGCAAACAACGGTATCTCCGATTCTGTCAATGCTCTGTTGCCA
TTCCTCGCAGCACACAATACCATCACCGCTGGCGATCTTATCCAATTCGCAGGGGCTGTTGGAATCAGCAACTGTCCTGGAGCTCCTCGGTTGCAGTTCTTGGCTGGTCGTCCTAACGCG
ACTGCTCCCGCCCCTGATGGTCTTATTCCAGAGCCGCAAGACACTGTCACAGATATTCTCGCTCGCTTTGAAGACGGTGGAGGATTCAGCTCCGACGAAGTCGTTGCGTTGCTTGCATCA
CATTCGATTGCTCGTGCAGACCATGTTGACCCGAAGTTCAAAGCTGCTCCTTTTGACAGCACTCCGTTTGATTTCGATACTCAAATCTTCGTTGAGGTCTTGCTCAGAGGTGTTGGGTTC
CCCGGAACTGGAGGTAACCAAG
GTGAAGCCGAGTCTCCTTTGCCACTAACAAATGGTGAAGATGTCGGTGAACTTCGTCTCCTATCTGATCAGACAATCGCACGTGACTCAAGGACTGCA
TGCACGTGGCAAGGGTTCGTGAACCAGCAAGAGAAGATGGCCAGTGCTTTCCAAGCTGCCATGGCCAAGCTCGCCGTTGTCGGTCAGGATGTGTCCTCGTTGATTGACTGCTCTGAGGTC
GTTCCTATCCCAGTTCCTTCCTCTGGAAAGCCTGCGAC
ATTCCCTGCTACCAAAACTATTGCAGATATTGAGCAGGCATGTGCTAATGCGCCGTTCCCCAGCCTTGCCTCCGATCCTGGT
ACAATAGAGACCTTGATTCC
TCATTGCCCTGACGGTTCAGAGGACGACTGCGACTCCAG

Retrieve as FASTA