Entry information : SsteMnP20
Entry ID 12339
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2013-05-30 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-20 (Catherine Mathe (Scipio))
Peroxidase information: SsteMnP20
Name SsteMnP20
Class Manganese peroxidase    [Orthogroup: MnP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sphaerobolaceae Sphaerobolus
Organism Sphaerobolus stellatus    [TaxId: 68786 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsteMnP20
start..stop
S start..stop
SsteMnP15 715 0 1..376 1..376
SsteMnP03 686 0 1..376 1..376
RrubMnP06 623 0 1..370 1..373
RrubMnP07 621 0 1..370 1..371
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 528632..528786 155 N° 2 528850..528902 53 N° 3 528962..529489 528 N° 4 529551..529644 94
N° 5 529703..529864 162 N° 6 529920..530021 102 N° 7 530076..530109 34  
join(528632..528786,528850..528902,528962..529489,529551..529644,529703..529864, 529920..530021,530076..530109)


exon

Literature and cross-references SsteMnP20
DNA ref. JGI genome:   scaffold_30 (528632..530109)
Cluster/Prediction ref. JGI gene:   164843
Protein sequence: SsteMnP20
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377 (358)
PWM (Da):   %s   39465.5 (37529.5)  
PI (pH):   %s   4.4 (4.35) Peptide Signal:   %s   cut: 19 range:19-376
Sequence 418
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKTLAAFATLATLVQAMPATQLVTCPDGNKASNAACCPFFALRDDLQANLFDNQCGEDAHEVVRLTFHDAIAISSSLKGQGKPAGGGADGSMLVFPDVEPNFSANNGISDSVDALLPFLATHPVTAGDLIQFAGAVALTNCPGAPKLEFLAGRPNATAPAPDGLIPEPQDAVEKIFSRFSDGGGFTPDEIIALLASHTIARADHVDPTLDAAPFDSTPFTFDTQIFVEVLLKGIGFPGTGNNTGEVESPLPTTFEKDVGELRLQSDFALARHPTTACTWQGFVNEQEKMANAFKLAMAKLAVNGQDTRHFVDCSEVIPTPLPAVKKPATFPATKTRADIQQACFASPFPNLASDAGATETLIPHCPDGTMNCVS*

Retrieve as FASTA  
Remarks complete sequence from genomics (6 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCTTCAAGACTCTCGCTGCCTTTGCTACTCTTGCCACCCTTGTGCAGGCCATGCCAGCCACTCAGCTGGTTACTTGCCCTGATGGTAACAAGGCTTCGAACGCTGCCTGCTGCCCGT
TCTTCGCCCTCCGCGATGATCTCCAAGCTAACTT
GTATGTGCCCCATATATTTGAGTCGGATTGGAGGGATATTCACATATTTTTTCCCCTATATAGGTTCGACAACCAATGCGGTGAAG
ATGCTCACGAAGTCGTCCGTCTTACTTTCC
GTCAGTAAAAAATAAAAAACGCCACTGGTTAATCACTGCTTACTGAATAATATATTCAGACGACGCCATCGCCATCTCGAGCTCCTTGAA
GGGTCAAGGAAAGCCCGCCGGTGGAGGAGCTGACGGTTCCATGCTTGTCTTCCCTGACGTCGAACCCAACTTCTCCGCCAACAACGGTATTTCCGACAGTGTCGACGCCCTTTTGCCATT
CCTCGCAACCCACCCAGTCACCGCAGGCGATCTTATCCAGTTCGCAGGTGCAGTTGCCCTCACCAATTGCCCCGGTGCCCCGAAGTTGGAATTCTTGGCTGGTCGTCCCAACGCGACTGC
TCCCGCTCCCGATGGTCTCATCCCCGAGCCTCAAGACGCCGTTGAGAAGATCTTCTCTCGTTTCTCTGACGGTGGAGGATTCACCCCCGATGAAATTATTGCCTTGTTGGCTTCCCACAC
CATCGCCCGTGCTGACCACGTTGACCCGACTCTCGATGCTGCTCCCTTCGATTCTACTCCTTTCACTTTCGACACCCAGATCTTCGTGGAGGTCCTTCTCAAGGGAATTGGCTTCCCCGG
AACTGGCAACAACACTG
GTAAATTTTTATATTTATTCAAGGTATTTCTAATTATCTTACCATTGTCATTGAATAACAGGCGAGGTTGAATCTCCTCTCCCTACCACCTTCGAGAAGGACG
TCGGTGAACTCCGTCTCCAATCTGATTTTGCCCTTGCTCGCCACCCCACCAC
GTACGTCTGCTTTTAATTTTTAAAATGGTCTTCTCTATAATTTTCCTTCGTTATCTAGTGCCTGCACA
TGGCAAGGATTCGTCAACGAGCAAGAAAAGATGGCTAACGCCTTCAAACTTGCTATGGCTAAGCTTGCCGTCAACGGTCAGGACACCAGGCACTTCGTTGACTGCTCTGAGGTCATCCCT
ACCCCGCTCCCCGCTGTCAAGAAGCCTGCTAC
GTATGTCAATATCTCTTGATATGTTCGTTCAGATGCTCACCTTTATATTCTATAGTTTCCCCGCTACCAAGACCAGAGCTGACATCCA
GCAAGCTTGCTTCGCTTCGCCTTTCCCCAACCTCGCTTCTGATGCCGGTGCAACCGAGACTCTCATTCC
GTGCGTTGCCATTTTCGATGCTTGAGATTACGGCTAATTCCTTTTCATATA
TAGTCACTGCCCCGACGGAACCATGAACTGCGTCTCG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCTTCAAGACTCTCGCTGCCTTTGCTACTCTTGCCACCCTTGTGCAGGCCATGCCAGCCACTCAGCTGGTTACTTGCCCTGATGGTAACAAGGCTTCGAACGCTGCCTGCTGCCCGT
TCTTCGCCCTCCGCGATGATCTCCAAGCTAACTT
GTTCGACAACCAATGCGGTGAAGATGCTCACGAAGTCGTCCGTCTTACTTTCCACGACGCCATCGCCATCTCGAGCTCCTTGAAGG
GTCAAGGAAAGCCCGCCGGTGGAGGAGCTGACGGTTCCATGCTTGTCTTCCCTGACGTCGAACCCAACTTCTCCGCCAACAACGGTATTTCCGACAGTGTCGACGCCCTTTTGCCATTCC
TCGCAACCCACCCAGTCACCGCAGGCGATCTTATCCAGTTCGCAGGTGCAGTTGCCCTCACCAATTGCCCCGGTGCCCCGAAGTTGGAATTCTTGGCTGGTCGTCCCAACGCGACTGCTC
CCGCTCCCGATGGTCTCATCCCCGAGCCTCAAGACGCCGTTGAGAAGATCTTCTCTCGTTTCTCTGACGGTGGAGGATTCACCCCCGATGAAATTATTGCCTTGTTGGCTTCCCACACCA
TCGCCCGTGCTGACCACGTTGACCCGACTCTCGATGCTGCTCCCTTCGATTCTACTCCTTTCACTTTCGACACCCAGATCTTCGTGGAGGTCCTTCTCAAGGGAATTGGCTTCCCCGGAA
CTGGCAACAACACTG
GCGAGGTTGAATCTCCTCTCCCTACCACCTTCGAGAAGGACGTCGGTGAACTCCGTCTCCAATCTGATTTTGCCCTTGCTCGCCACCCCACCACTGCCTGCACAT
GGCAAGGATTCGTCAACGAGCAAGAAAAGATGGCTAACGCCTTCAAACTTGCTATGGCTAAGCTTGCCGTCAACGGTCAGGACACCAGGCACTTCGTTGACTGCTCTGAGGTCATCCCTA
CCCCGCTCCCCGCTGTCAAGAAGCCTGCTAC
TTTCCCCGCTACCAAGACCAGAGCTGACATCCAGCAAGCTTGCTTCGCTTCGCCTTTCCCCAACCTCGCTTCTGATGCCGGTGCAACCG
AGACTCTCATTCC
TCACTGCCCCGACGGAACCATGAACTGCGTCTCG

Retrieve as FASTA