Entry information : ZmaPrx08 ( Zosma23g00760 [2.2])
Entry ID 12523
Creation 2013-11-05 (Qiang Li)
Last sequence changes 2016-04-07 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-04-07 (Achraf Jemmat)
Peroxidase information: ZmaPrx08 ( Zosma23g00760 [2.2])
Name (synonym) ZmaPrx08 ( Zosma23g00760 [2.2])
Class Class III peroxidase     [Orthogroup: Prx004]*
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Zosteraceae Zostera
Organism Zostera marina    [TaxId: 29655 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmaPrx08
start..stop
S start..stop
ZmaPrx13 343 1e-117 1..331 1..343
RcPrx88 315 2e-106 7..331 4..321
PabPrx118 314 2e-106 7..331 5..321
PtaPrx119 312 2e-105 17..331 19..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 644834..645055 222 N° 2 644554..644757 204 N° 3 643722..644417 696  
complement(join(643722..644417,644554..644757,644834..645055))


exon

Literature and cross-references ZmaPrx08 ( Zosma23g00760 [2.2])
Protein sequence: ZmaPrx08 ( Zosma23g00760 [2.2])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   374 (347)
PWM (Da):   %s   40922.29 (37901.6)  
PI (pH):   %s   4.53 (4.46) Peptide Signal:   %s   cut: 27 range:27-373
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFSLKVFMISLWLILLSSRISDVNGGALQIGFYNTSCPTAEAIVRDVVEQAILLNDLVPARLLRLYFHDCFVRGCDASLLLDNPNPTRGTVKVEKEADPNLTVRGYDVIDTAKATLEEQCPGIVSCADIAAIAARDSVAHLNGSAYYEVETGRRDGNISIASEAVAALPDAFGNFSYLRSNFANVGLNVKDLVVLSGGHTIGQSQCRSFSRRIYNYTMTQAPDPSLNLTFLPYLREQCPVGQDGNLVEMVADDSRTFDNDYYVNVMQNKGLFHSDGALLTDDEATAYVMNYIANQSAFFQDFGVSMRKMGENQVLTGQEGEIRLNCGRINGDDTTPMTPPTVPGVPAAASRNFNFINLTHFLFVTLFYITFL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTAGTTTAAAAGTGTTTATGATCAGTCTTTGGTTGATCTTGTTGAGTTCCAGAATCAGCGATGTCAATGGAGGAGCTTTACAGATTGGGTTCTATAACACCTCATGCCCCACT
GCCGAAGCCATAGTTCGCGATGTAGTTGAACAAGCAATCTTGTTAAACGATCTTGTCCCTGCCCGTTTGCTGAGACTCTACTTCCACGATTGCTTTGTTCGG
GTAAATATGTAATTTATA
TTTGCAAAAAAAAAACGTGATTTATGTGATTAATGATGATTAATCTTTAATCACATAGGGATGTGATGCTTCTTTGTTGTTGGATAACCCAAATCCCACAAGGGGCACCGTTAAAGTCGA
GAAGGAAGCCGACCCGAATCTAACCGTACGTGGGTACGATGTCATCGATACTGCAAAAGCCACTTTGGAAGAACAATGTCCCGGAATCGTCTCCTGTGCCGATATCGCCGCTATCGCTGC
AAGAGACTCCGTCGCACACTTG
GTAAACATAAACAAATTACTTTTGAGTTTTGTATACAGGGAGATTAGCTCTCAGGTCGTGTTAAATTATTATTAAAGTTCGTTGTGTGTGTAATTTTC
ATTTAATTTTCAGGGTTTAAATGTTTGGTTGTTTGTAGAATGGATCGGCATATTATGAGGTGGAGACAGGAAGAAGAGACGGTAATATATCGATCGCTTCGGAAGCGGTGGCTGCTTTAC
CGGATGCGTTCGGCAATTTTTCGTATTTGAGAAGCAATTTCGCCAATGTTGGACTCAACGTTAAAGACTTGGTCGTTCTTTCCGGTGGGCACACGATTGGTCAATCCCAATGTCGGTCGT
TCTCGAGACGTATCTATAATTACACCATGACCCAAGCACCCGACCCGTCTTTGAATCTAACCTTCCTCCCCTACCTTAGAGAACAATGCCCGGTGGGACAAGATGGAAACCTGGTTGAAA
TGGTAGCAGATGATTCCCGGACATTTGATAACGATTACTACGTGAATGTGATGCAGAACAAGGGGCTGTTCCACTCGGATGGAGCTCTGCTTACCGACGATGAGGCGACCGCCTATGTCA
TGAACTACATCGCTAACCAGTCCGCGTTCTTCCAGGATTTTGGCGTTTCCATGAGGAAAATGGGAGAAAATCAAGTTCTGACAGGTCAGGAAGGTGAGATAAGATTGAATTGTGGTAGGA
TAAACGGAGACGATACCACACCAATGACACCACCGACCGTACCCGGTGTACCCGCTGCTGCATCCAGGAATTTTAATTTCATCAACCTCACTCACTTTCTCTTTGTCACTCTCTTTTATA
TAACATTTCTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTAGTTTAAAAGTGTTTATGATCAGTCTTTGGTTGATCTTGTTGAGTTCCAGAATCAGCGATGTCAATGGAGGAGCTTTACAGATTGGGTTCTATAACACCTCATGCCCCACT
GCCGAAGCCATAGTTCGCGATGTAGTTGAACAAGCAATCTTGTTAAACGATCTTGTCCCTGCCCGTTTGCTGAGACTCTACTTCCACGATTGCTTTGTTCGG
GGATGTGATGCTTCTTTG
TTGTTGGATAACCCAAATCCCACAAGGGGCACCGTTAAAGTCGAGAAGGAAGCCGACCCGAATCTAACCGTACGTGGGTACGATGTCATCGATACTGCAAAAGCCACTTTGGAAGAACAA
TGTCCCGGAATCGTCTCCTGTGCCGATATCGCCGCTATCGCTGCAAGAGACTCCGTCGCACACTTG
AATGGATCGGCATATTATGAGGTGGAGACAGGAAGAAGAGACGGTAATATATCG
ATCGCTTCGGAAGCGGTGGCTGCTTTACCGGATGCGTTCGGCAATTTTTCGTATTTGAGAAGCAATTTCGCCAATGTTGGACTCAACGTTAAAGACTTGGTCGTTCTTTCCGGTGGGCAC
ACGATTGGTCAATCCCAATGTCGGTCGTTCTCGAGACGTATCTATAATTACACCATGACCCAAGCACCCGACCCGTCTTTGAATCTAACCTTCCTCCCCTACCTTAGAGAACAATGCCCG
GTGGGACAAGATGGAAACCTGGTTGAAATGGTAGCAGATGATTCCCGGACATTTGATAACGATTACTACGTGAATGTGATGCAGAACAAGGGGCTGTTCCACTCGGATGGAGCTCTGCTT
ACCGACGATGAGGCGACCGCCTATGTCATGAACTACATCGCTAACCAGTCCGCGTTCTTCCAGGATTTTGGCGTTTCCATGAGGAAAATGGGAGAAAATCAAGTTCTGACAGGTCAGGAA
GGTGAGATAAGATTGAATTGTGGTAGGATAAACGGAGACGATACCACACCAATGACACCACCGACCGTACCCGGTGTACCCGCTGCTGCATCCAGGAATTTTAATTTCATCAACCTCACT
CACTTTCTCTTTGTCACTCTCTTTTATATAACATTTCTGTAA

Retrieve as FASTA