Entry information : ZmaPrx12 ( Zosma7g00160 [2.2])
Entry ID 12535
Creation 2013-11-05 (Qiang Li)
Last sequence changes 2016-04-08 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-04-08 (Achraf Jemmat)
Peroxidase information: ZmaPrx12 ( Zosma7g00160 [2.2])
Name (synonym) ZmaPrx12 ( Zosma7g00160 [2.2])
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Zosteraceae Zostera
Organism Zostera marina    [TaxId: 29655 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmaPrx12
start..stop
S start..stop
ZmaPrx39 525 0 6..333 13..341
ZmaPrx07 509 0 1..333 1..332
NtPrx68-2A 455 2e-162 5..332 1..328
NtPrx47-1B 455 2e-162 5..332 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 113930..114151 222 N° 2 113488..113688 201 N° 3 112817..113398 582  
complement(join(112817..113398,113488..113688,113930..114151))


exon

Literature and cross-references ZmaPrx12 ( Zosma7g00160 [2.2])
DNA ref. Phytozome 12:   scaffold_7 (114151..112817)
Cluster/Prediction ref. Phytozome Gene 12:   33180220 [Incorrect prediction]
Protein sequence: ZmaPrx12 ( Zosma7g00160 [2.2])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334
PWM (Da):   %s   36307.14 Transmb domain:   %s   i7-24o
PI (pH):   %s   7.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEKNMSNMATLVCIIGVVSFLVGFSSGELQLGFYDNSCPKAEKLIKEFVQEHIPNAPSLAATLLRMQFHDCFVRGCDASVLLNVSSTKPFNATEKTAVPNMSLRGFDFIDRVKSIVEKECPGVVSCADIISLVARDSVVVTGGPYWKVPTGRRDGTISNATESLNNIPAPTFNFSSLTKSFAKVGLNVKDLVLLSGSHTIGVGHCSAFSSRLYNYTGVGDEDPLLDSEYAANLRNSKCTNPNDNVTFVEMDPGSARTFDLDYYKQVLKRRGLFHSDAALTTDSDARSIIMDLVNSSPSKFYKAFGLSMEKMSRAQVKTGTEGEIRKHCALPNNH*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). Incorrect prection from Phytozome (extra 3' intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAGAACATGAGTAACATGGCGACCCTAGTTTGCATCATTGGAGTTGTGAGCTTTCTGGTGGGTTTCTCTTCTGGAGAGCTTCAACTTGGGTTCTACGATAATTCATGCCCTAAA
GCTGAGAAATTGATCAAAGAGTTCGTTCAAGAACACATTCCAAATGCACCAAGTTTAGCAGCTACTCTTCTTCGGATGCAATTCCATGACTGCTTTGTCAGG
GTGAGCACTCATTTTTAA
GGTTCTTAATATATATAGAAAACGATTCATTCTAACGAGATATTTTTCATTTTGCCATTAATTTTTTTTTATTTCACGCTACTTTACTATCATTATCGATTTTTTTTTTGTCTTTTGTGG
ACTACATCTAGAAGAACAGAAGATCGAAATTAAATATCTCTATGAAATTAGCTAGCTAGTCCTATATATATGATCGACTGATGAAATTTATTTTACAAACTAGGGTTGTGATGCCTCTGT
TCTTCTAAATGTCTCGAGCACCAAACCCTTCAATGCCACAGAGAAAACAGCGGTTCCAAATATGTCGCTCCGAGGATTTGACTTTATCGACAGAGTTAAGAGCATAGTAGAAAAAGAATG
CCCTGGTGTGGTGTCCTGTGCTGATATCATTTCTTTGGTAGCCCGCGATTCTGTTGTAGTCACG
GTAAACTTATAAACGAAATTCGGATCAGTAGTTTCTCATACAATGTCTGATTTCTT
GTAATGAACTGAAATATGATTGCTTGATTGCAGGGAGGGCCGTATTGGAAGGTTCCAACAGGAAGAAGAGATGGGACAATATCGAATGCCACAGAATCACTGAACAACATTCCGGCACCC
ACTTTCAACTTCAGCAGTCTTACGAAATCATTCGCCAAAGTAGGACTCAACGTCAAAGATCTCGTCTTGCTGTCGGGATCTCACACCATCGGAGTTGGGCATTGCTCCGCTTTCAGCAGT
AGACTCTACAACTACACCGGCGTAGGGGATGAAGATCCATTATTGGACAGCGAGTACGCCGCAAATTTAAGAAACTCCAAGTGCACAAACCCTAACGACAACGTAACATTCGTGGAGATG
GATCCCGGAAGCGCTCGGACATTCGATCTAGATTACTACAAGCAGGTTCTGAAAAGGAGAGGACTCTTCCATTCAGACGCTGCACTGACCACAGATTCCGATGCCAGGTCTATCATAATG
GACCTCGTCAACTCTTCACCTTCGAAGTTCTATAAAGCCTTTGGACTTTCCATGGAGAAGATGTCTAGAGCTCAAGTGAAGACCGGAACTGAAGGTGAGATCAGGAAGCACTGTGCATTA
CCCAATAATCACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAGAACATGAGTAACATGGCGACCCTAGTTTGCATCATTGGAGTTGTGAGCTTTCTGGTGGGTTTCTCTTCTGGAGAGCTTCAACTTGGGTTCTACGATAATTCATGCCCTAAA
GCTGAGAAATTGATCAAAGAGTTCGTTCAAGAACACATTCCAAATGCACCAAGTTTAGCAGCTACTCTTCTTCGGATGCAATTCCATGACTGCTTTGTCAGG
GGTTGTGATGCCTCTGTT
CTTCTAAATGTCTCGAGCACCAAACCCTTCAATGCCACAGAGAAAACAGCGGTTCCAAATATGTCGCTCCGAGGATTTGACTTTATCGACAGAGTTAAGAGCATAGTAGAAAAAGAATGC
CCTGGTGTGGTGTCCTGTGCTGATATCATTTCTTTGGTAGCCCGCGATTCTGTTGTAGTCACG
GGAGGGCCGTATTGGAAGGTTCCAACAGGAAGAAGAGATGGGACAATATCGAATGCC
ACAGAATCACTGAACAACATTCCGGCACCCACTTTCAACTTCAGCAGTCTTACGAAATCATTCGCCAAAGTAGGACTCAACGTCAAAGATCTCGTCTTGCTGTCGGGATCTCACACCATC
GGAGTTGGGCATTGCTCCGCTTTCAGCAGTAGACTCTACAACTACACCGGCGTAGGGGATGAAGATCCATTATTGGACAGCGAGTACGCCGCAAATTTAAGAAACTCCAAGTGCACAAAC
CCTAACGACAACGTAACATTCGTGGAGATGGATCCCGGAAGCGCTCGGACATTCGATCTAGATTACTACAAGCAGGTTCTGAAAAGGAGAGGACTCTTCCATTCAGACGCTGCACTGACC
ACAGATTCCGATGCCAGGTCTATCATAATGGACCTCGTCAACTCTTCACCTTCGAAGTTCTATAAAGCCTTTGGACTTTCCATGGAGAAGATGTCTAGAGCTCAAGTGAAGACCGGAACT
GAAGGTGAGATCAGGAAGCACTGTGCATTACCCAATAATCACTGA

Retrieve as FASTA