Entry information : SsPrx03_AU1
Entry ID 12583
Creation 2013-11-12 (Qiang Li)
Last sequence changes 2014-01-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-03 (Christophe Dunand)
Peroxidase information: SsPrx03_AU1
Name SsPrx03_AU1
Class Class III peroxidase     [Orthogroup: Prx155]*
Taxonomy Eukaryota Viridiplantae Streptophyta Zygnemophyceae Zygnemataceae Spirogyra
Organism Spirogyra sp    [TaxId: 3181 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsPrx03_AU1
start..stop
S start..stop
SpraPrx02 419 1e-147 43..334 57..348
SpraPrx01 262 2e-86 43..334 38..326
SsPrx06_AU1 244 8e-80 45..334 37..316
SsPrx07_AU1 211 6e-67 43..327 35..311
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..126 126 N° 2 2592..2708 117 N° 3 2812..3000 189 N° 4 3152..3317 166
N° 5 3537..3804 268 N° 6 3917..4055 139  
join(1..126,2592..2708,2812..3000,3152..3317,3537..3804,3917..4055)


exon

Literature and cross-references SsPrx03_AU1
Literature Looking for Ancestral Class III Peroxidases in Green Lineage
Protein sequence: SsPrx03_AU1
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334
PWM (Da):   %s   37235.35  
PI (pH):   %s   10.11
Sequence 375
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSESKPSYFLALRTLDTQHHSKILRNRDTRLWKNHFVQDRMKACPQLENLVNRAFEAQWKKDRSVSPAILRLFFHDALVNGVDGSILLNGTGTNLAEKDNPDVKHLRGFDALERVKATVEASCPRKISCADTLTLMTKFAVIKSGGPEIDFNLGRLDGFSSNLELAKLLTPRHFSTATALLNIFFLLGLSQVDLVALSGAHTIGVAHCESVRTRIYPTIDTKYEPQFGISVRKSCPIVDPSQNPPLLDPNATLKLDQTSTVFDNSYFQGLRSNRGLMTSDNNLNADPRLNSQVAKFASNQSAFFNQFRLSMKKLSEINLRSVGNVRRKCYKLN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Sequenced by EEP in LRSV. Containing motif fhda. Missing 'c'. Containing IntR (5'). Containing IntR (3').
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATAACACAAT CAGATAAAGC GAAAGAATGA AATAGCGACA GTAACACAAA CACTGTTTTG TTTAGAGTAA AACGGAAACG TAGGGACGAG GCCCAAACAT TCCAGAGAAC AAAAGACAAA  AGATTGAAAC CTAAAAAGTA TTATAAATCC ATATGCTTGA ATGAGCATTC CTATCATGGC CCATCCAATA ACCACAAGAA AAAATCCAGA CAGGAAGAGT ATGGAGCCCT GGGAAGGGAA  AATCAGAACA AAACATTCGA AAGAGTGAGT AGAACAATCA AACAATGAGA ATTCCAAATG CAAAATAAAT AAACCAATAT ATAAGTACAA AGTAAGTGAC GATTTTCGAT AATGCATGGG  ACAGAAAATG ATGAATTGAT AAAGGTAACG ATGTACGTGA GACAAAACGA AGTAAAAGGA TGAGTGAAAA GAATGACACT TTTCGATTTC TTCTTCTTGA AAAAAAATTG ATTGTTTTTG  TAAAACCAAT TGTCAATGTA ACTCCGCTCA GAAACAGAAT CTTTGAAATA AAATATAAAA GGCATGGAAA ATGAACGACG GGGTCAGTAC GTGAATTCAC AAACAACACA AATAAAAAGC  GAGTACAAAT TTTGCAAGAA CGGATTCCGG TGAATGAGGT TAAGGAAAAA TTGGTTACTG GAATCAAAAT TTTGCATGGA TCAATGAATC AAAAGGATCT CCTAGAATAT CAGGAGGAAG  AAAATGCATA ACGGAAGAAT GGGTTGAAAT CAAATTTATT GGATACACAT ATACATGTAT ACTTGTCCGA TTTGTTACAT TTTCTAAAAA GGAATACAAC TTGGTGAACG CAAGCAATAC  ATATCAACAA AGAAAAACGT AATCAGGCAC ACATTTCCCA TCGCAAGTAA TCCTTTATCG AAGAAAAAAA TAATTCCGAG GAAGGAGAAC AAAACGCCGA AGGCGGTCAA TCCAATCCCA  ATTTCTAAAA ACGGAAAAAT AAGCGACGAA GCGGTTGAGA AAAGGCAAAA TTTGTCCGAT CCGTGGTGAT GGATTCCCAA GCAAGGAACA ACAAGTTCAC CAAACGGAAA AAAAGATAAA  AAAATAAGAA AATAAAAAAT ACAAATTCAG CATGTTTGAC TCCAATTTCA CACAAAAAAA TTAGGAAAAA AAATCATGAA AAAATAGAAG GACCGAAGCG AAGAGATGCA TACATAGATA  ACAGATACTT TGATGGATAA AGAAATATGC AAACACGAAA ATCGCAACGC ATCCAAATGC AAAATTACAA AAATTTCAGA ATCTAAGTAT GTCCAATTTC AGCGTTTTGA ACATACTTTT  CCGATCGTTC ATTTCAAAGG GCGACATCAT CGTGAAGCTG GCGCGTTCCT CCGGTTTGGA AAGCCGAGTT GTTGGAACGA GGCCGCGGGA AGCAGAGACA CTGGACCACC GAGGAACTGA  GTAGGGGAGT AGGAATAGAG TAGGAACCGG AACAGGGGAA GGGACTAGGA AAGTAGGTCG AAGTATAGGA TCGAGACAAG GGAGACTCGA GAGAAGGGCG CGGGAAGCAG AGACACTGGA  CCACCGAGGA ACAGAGTAGG GATAGGATAG GAACCGGAAC AGGGAAAGGG ACTAGGAAAG TAGGTCGAGG GATAGGCAGG GACGCGATGA GCGCGAGAGA TGATCGGTTG GGTTACCATT  GGGTAGCTGT GTTAAGGATG ATAACGCCTA GACTATATCT CGTCCTAGAG TTGGAGTTTA AGTCAAAACT AGGATACGAC TGTTCTTTAG GTGTTCGTCC AATGATTCAG CCAATCGAGA  TTCGCCATAC ACGTAAGAAT TCGAAAACGG GAGAAACTTT CGTGTATGGA TAAATCGTGA TTGGCTGGAA GTTTTGAACG AAGACCTAAT GAACAGTCGT TCCCTAGTTT TTTACCCTAA  TTCGAACTCT AATCAGAGAC AGACCGCGAT ATTCTAACAC CAACTAACCC ATAAAACCTA GTCCACAAAC AACTCCGATT GGTTGCTCTC CCCCTGAAGT ACAACAATGC TATTATTGTC  TCGAATGGTG TACTTCAGTC CCGAAGAAGA CAAATAGAGT TTTGTACTTC AGGGGGAGAG CAGCCAAAGA TTTCTGGACT GGCCTAGTTT ATTAATTCAA ACTAGTTTTA CGATTTGACT  TGAACCACAG ATTAAATCTG CAGCCATATA CCAACGTACT TTCTCCGATT CTTGTGGTGA ACCCTCTAAA ATAGAATGCC TAAGATTTGA AGGGCATTAG GGTTAGGAAC TGGGATTAGG  GTAATTCAAT TTTTAGGTAT GTAATTGTCA TCTTACGCTC GAGTTTCTGC AATTTGGATT CTGGATTGTT GAATTTAGAG TTTCGAATGA GTAATCAAAT TTTGTCCCTT AGATTCATCA  AACCACAAGT GTGTAGCTTG AAAGATGTTG TCTACTGTGT ACTTAAATGA ATGAACTTGG TATAGCAAAT CCAAATGCAG TTTCCCCACA CCTGTAATCA CTTGAAATCT CTTCTATCCA  ACTTAATCCG CAACAAATGG AATTAAAATT GGTTCTATTA ACCATGTTTT GGGTCAGAAG TGAGGTCGTT AATCGTTTCA ATCAGAACCT TGGCAGCGCC CATCAGTTTA TAGTCAATCA  TCACCTGGGA AAAGGTTTTG AAGATTGGAG GTGTTAGATG CGCAACCAAT TATACAAGTG TAAAAAAATG AACACGGAAA TCAAACGGGT ACACAATAGC GAAGTCACAC TTGCATGTAT  CCATCGAGTT TGAGGTGCAG TGTATCGTTC TCAGGGCTCA AATACAGCAA TCGTGATGTA ACATTGTACC ATTTGGATCC GGGTTGCCAC ATGTATACAA AGTCGTCAAT CGTGAAGACG  CAATACAACT TGGAGAGGGG CAGAAAAAAG CCTGGGGTGC GCTCATTCGA AGCAATGTAC ACCCTTCGTG TTGGCTTAAC TTTAGATGGG AGCTTGACGA GTAAGCTATA AAAAGGAGAT  GATCAAATGG ACCAACAAAT ACTTCAAAAA ATTGCGCACT CAATCGGGGC CAGTAACTTC GCATCATGGA ACAAATATAT GACAAAGTGT GCAGGAATAA AAAAAAATTG TAGAATATCA  GCTGTGTTGT AGACGCTTGA GATTAAAAAA ATTGTTGACT TTCACTGAGA GGGTTGGATT GCTCTCTAAG GACTGTAGGA GTGTAAAATA GTACTCACCT TTCTGGCCTG GTATCCTGCT  CCACATTTGG CCATTTGTTT TTGTCCGCCG CCTTATCCCC TCCTCGAAAT CCCACTGCAG CGTGTTGCCG ATGTGTTGAT AAATGGGTTC GAGAAGCGGG GACAAAGAAT TCAGTGCGGC  ATACGGGATT TCAAAATCCT ATGAAAGTGT GCCCCCGAAA TGTTTATTGA TTTATGATGT TAATTGAAAA GCCAGATAAT TTTAGCAAGT ATGGATATTC ATGAAAGATG GAATGGAAGG  GATTATACAT AAAAATATGC ACCATGAAAT TGGATAATGC TGAATGGGTA ACGACGACAA TTCACATGAA TATCATTTAA ATGCAAGGAT ATCTTTCATG AGATTCGAAC ACGCAATGGT 
GAGGTACAGA GACATATGTG ATAGTAAAGA GTTTCAAAGT GC 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGATGCCATT TCACCTTGGG ATGGCCCTGT GTTAAACCAC AAAATTTAAA CCGAGAAGAA TCCATGTCAT GAAATGTGCC TCTACAATTA AAAACGGGAT GTCATTCAAT TCAACAGAAG  TGCATTTGTT CTAAAATTCC CACATTTCCA TCAATCTCTT GTCCATTTAG AACTAGATTA GGGGTTTCCC CTATTCACCT GAACCTTGTT TAATAGCAAA TATCAATTGG ATTTGTGAAA  GCAAATTGAG ATCTGTACAT AGCTACCTCA AGGGTTCTCA AGGGTCTGAA TAGCCCATGA ATGTCAAACC AAACAGTAAT TATCCACGGG TGTTCAGGAC TAGGAAGCTG TGTCAAGGAA  AGTAGGTTAA TAAACAAATG CCTATATGTC AGATACGGTT TAAAATTCCA GTGTAAGGTC TCGGACCTAC CAGGTGGTGG GGAATGTGCT TAAGCAATTC AGGTCAAACT CAACCGATCT  AAGTCAGATA GTCTCCCAGG ACCTACGACT CCTTAGTCTA AGACTCAAAG GAAGGACCAC GGAGATACCT AGTGAAACCC AAAGAAAGAA GGGCACATCT ACCGACTAGG TATGCACAAA  TTTTCTAAGT TGATTAATAT AATACCGAAT TACCTGGCTG TGGACATGTT ACCCACTCCG TGATATGACA AGGCCAGGTT CCAAGTGTTC AGAAAGGATA AAGAAAAACT GGTGTCGTAT  TCGTAGTAGG AAAAAAATTC TAAGATGGGA TAGAAAATCA AGTGTAATGG AAAGAGGAGT AAAATTGTAA GAACGGTAGA AAGAATAGGA ATACGAATAC AAGTTTAAAT ATAGAAGGAA  TTGAACAGAA GCTATGTAGA ATATGTTCTA AACAATTGGA TGATACAGTG AAAGCAGAGG TTACATACTA CGTTTGGAAT CGAAGAAAAA GGAAGATAAG AAGAAAAAAA ATAGTCTGAT  GGATTGAAGG GTGATTTAAT CCATTTTTTT TAGGGTGTCA AATGATTTAA TAACTAAAAT GGAAGACGAA AAGAGTTTGA AAGTCAAGTT AGGATTGGGT GATACAAAGT GATATGCTTA  TACAATTTGC AATGCGTATT TTGTAAACAC TACATAGAAA TCAGAAAAAA TTTACCTTAT TTCAAACCAT GGTCAATCTT TATCACCCAT CACTGCCTCA TTAAAATTTT TGGTTTCCCA 
TGTGCTCGTG AAACGCCACA CATTAACACA ATTTATCAGA GCTGAAATTC AAATCGGAAA TAGATGT 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGGTAGCGAATCCAAACCTTCATATTTTCTGGCACTTCGCACACTTGATACCCAACACCATTCGAAAATTCTCCGTAATCGTGATACAAGATTGTGGAAGAATCATTTCGTACAAGATA
GGATG
GTAAGCTCTCGTCGATTTTCCGAACTGTGAGGGAGCTGTTTCCCATAGACTCGAAAGTTTTCCAAGCACGAATGAATGATGCTTTGGGAGTAATTCTCACGTATCTTTACAAAGA
ATTGCAAATGACATCCACAAGAAGAAAGACAAATATGATATAGAAAGACGATTAAGCGCAATATGGCTGGGTTGTTAATGGTGAATGATATCCAAACATGAGATTTAAATTACAAAAAAA
TAAAGTAAAAAGAGAAGCCAAGTTAAAAGAATAAGAAAAAGTGTAAAAGAAAATGGGAAGGAGATTTGAAATAGTATAATTTCTAATAACTCGCAAGTCATAGTACATCGAAATCGGATT
GACCACCTATTTCCCGTTGTTATGCCCAGACCAAACACAAACTTGTTATGTCCAAGGTTAAGGTGCGGTTAAGATATTTTGCATCGGTAAGCAAGCAGAGGATACTCCATCTATTATATC
CGATTCCACTACACATTCTTAAATGGAGTCATACCCGGCCTTGCTTTTCTTCATGAACTCCCATGTGCAAAGTTTGCGATTAAAGTATCTACGAAACTCCCGCCCCTGTTCAAGTGCTGT
TCGAATTCCATAGGCAGTTCAACCCTCTACGCGAATCACCCCCCACCCCAAACGCTTCTCTCCAAAATTGAATGACGCGTACTTAAACCTCCCAGAGGGAATCACCCCATTTCAAATCGA
GGTGGATGGAATTTCACTTTTGGTAGATGATTTGATCATCCATTGAAATCATACATACAATTCAAAAATCCGGGTCATACATACGATTCAGAATTGAATATGGCTCAAGAAAAAATGAAA
GAATGGAGAAAGAAAACATTGTATCAATCGGAATCCTAATACGTTTGTCGTTTTGTGGAATCGGACTCCGACTTTTTATGCGATGAATGAGTCAATGAATCTTTGGAAGCTGATATCCGG
CAAATAACCTTGGCTCTTGGAGTTCCTGGGGCAGTTACTGAAATCGGTAACACAAGGAGAAAAATAAAAGGGCGAGATGGAACTTCGAAAGTTGGTGCGGTTTTACCTAAATTTGAATAG
TCGGTATGCGTGCGGGTTTATCCTAGTTTTGGACAACTGGGTAACAATCGTATTCAGTTACAACATCAACCAATCAGAGGAATACAAAATCGAATCATTGACTAATGAATTCCAAGGATT
CAACCGACACATGATTAATCTTTGTGGGTCATGCATGGGCAGGCCTATTTTTTTGGAAAATAGTAATTCTTTGGAAAATAATGTAGTAAAAATAGTCATTTTCCCTTAAACACTAGAATT
ACTGGAAACCTTGAAAATTTTGCCTATTACCAGAATACCCTAACCTAGTTTAGCGTTTTAAACAATCATTTTTGCCGTACAATTTTTTTCTGTAAAACAGTCATTTTTTTCGGATCAAAA
ATAGTAAAAATAGTCATTTATTTCGAAAATGACTGATTCTAGGAGGCCTGGTCCAAGTCCAAGTGAAGTCATCCTTGGAAATTTTGACTAATTCACTTTTTCTAGTTTGACCGTGTTAAC
CATTTTCCTAGGATAGCTACCGCTTATATGCATGCAGTGTTTCGTTAATTCAACTTTTCGATTTTACGCCCAACAGAATCTCAATAGAGTAAATGCCTTGCATTTGAATTAAAAAAAAAA
ACAAATATAGAAGCAAGACTGGAATTCTTTGCTTGACTTGATGAATAAACTTCGAATTTATCCACTTGCAATTTTTCATTTGGATTGGATGCATCTAACTCGAGGTGAATATCAGTAGTC
CGAGGTGATACTATTTTGTAATATTTATCATTCTAATTGATTATATCCCCAACCACAACAAAAATAACAACTGAGTACTGATTTTGAACTACAAATCTGGATTTCTCTATGAAGGTTTTG
ATGTAGGGTTCGCAAGGAGTACGGGATGTTCACAAACATTTGACAATTACTCCGTTTCCAAACGAGAGAGGTTGGCTTCAACTTCTTTGACTGGTTATTGACTTCACTTCCGAGGAAATG
TCCTCTATTACCCAAAATCTCTTCGTCTCCCAAACATCTTGAAGGGGGACATTGTAAGCTAACGTGGAAGAGGGCTACCCGAATTTGGAGTGTTTGGGGATGTTGGATGGCATGCGGTTG
CCGAATATTAAGCGACCCATGGATGCATCCGACTGCGGTTGCTTTTTTCTCCATGGAGTGGTTTCTTGTTTTTCATGTGAATTATGTGGGAACGAAAGCATTTTTCTTGAGGAAGTACTC
GCGAGAAATTCTACTCGCCCTTGTTTTTTTCTCCATTGGAATTGATTTTGCTGATTGTCAGGGTCGTGTGTTGTCTAGAGACTTTTACAAGGTACGTGAGTTTATTCCAATCGGATGCTC
AATTGATCATTGTAATCAATGAATTTGTGGGTATTTTCAGCTGTTGCCTGATTTTTTTTGGAATGTGTAGAAAGCATGTCCTCAATTGGAGAATTTGGTGAACCGCGCCTTCGAAGCTCA
GTGGAAGAAAGATCGTTCAGTATCTCCAGCGATTCTAAGACTCTTTTTCCACGACGCGCTTGTGAAT
GTCCGTCTTGCATTCTCATTTTCTTTCTTTCTTGCACTTTCTTCACCATTGCA
TGATTCATTGATATGTGAATTCCTCATTTTTACAATTCCCCCATTTTCAGGGAGTGGATGGATCGATTTTGCTCAACGGGACGGGAACCAACTTGGCTGAAAAAGATAATCCAGACGTGA
AGCATTTACGTGGATTCGATGCGTTGGAACGTGTGAAAGCAACTGTTGAAGCTTCCTGTCCCAGGAAAATCTCGTGCGCGGACACTCTAACTCTGATGACTAAATTCGCAGTTATAAAG
G
TCTCTTTCTCTTTAGAATCATCTCCACGTTCCCATTAGCATCGTCATCTTACAACTTGAATCCGCAGTGAATAAGTGGCGAGTCTTAACCCTAACCCCGCAATTGCTATCCATTATTATT
TTTCTCTCCCGAACATACATGATCCTTCAGTCTGGAGGTCCTGAGATCGATTTTAACTTGGGGCGATTGGATGGATTTTCTTCAAATCTGGAGCTCGCAAAATTGCTTACCCCTCGCCAT
TTTTCTACTGCGACAGCACTACTCAACATTTTTTTTCTTTTAGGCCTGAGTCAAGTTGACTTGGTTGCTCTCTCAG
GTACAAATTTGAAATGCTAATCTACAACATGGATGGCCCGTTCC
ATTTTCGCTTACCAATCTGTTCCATTTCGTTGTCCAGTTGTGATGTACAAATGGTTGTCCATGTATGAATTGCATCATCTTACACACTGTGCCGTTCTTGCAAATCCGCTATCCCTTTAC
TTTCCAATTTTCCCTCCTGAATCACCGGTGAGATTTTTTGAATCTAATTCTGTAGGCGCACACACCATTGGCGTCGCACATTGCGAGTCAGTTCGCACCCGCATTTATCCCACCATCGAT
ACAAAGTACGAACCTCAATTTGGAATCTCTGTGAGAAAAAGCTGCCCCATCGTGGACCCAAGCCAGAATCCTCCCCTTTTGGATCCCAACGCCACCCTAAAATTAGACCAAACGAGCACG
GTTTTTGACAACAGTTACTTTCAGGGATTGAGGTCGAACCGGGGATTAATGACTTCAGACAACAATTTGAATGCTGATCCCAG
GTCGTTTTCTATCATCTTCAGCATTTGCACCCCCCAA
ATTCCCAATTCCATACCCTTCTCATTTTGTTCCTCGTGTCTAATTGTCTCCCTGTTAACACTTGCAATCATTCAGACTCAATTCCCAAGTGGCGAAGTTTGCATCCAATCAGTCTGCGTT
TTTCAACCAATTTAGACTGAGCATGAAAAAGTTGAGCGAAATTAATTTGAGATCGGTGGGCAATGTCAGAAGAAAGTGTTACAAATTGAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGGTAGCGAATCCAAACCTTCATATTTTCTGGCACTTCGCACACTTGATACCCAACACCATTCGAAAATTCTCCGTAATCGTGATACAAGATTGTGGAAGAATCATTTCGTACAAGATA
GGATG
AAAGCATGTCCTCAATTGGAGAATTTGGTGAACCGCGCCTTCGAAGCTCAGTGGAAGAAAGATCGTTCAGTATCTCCAGCGATTCTAAGACTCTTTTTCCACGACGCGCTTGTGA
AT
GGAGTGGATGGATCGATTTTGCTCAACGGGACGGGAACCAACTTGGCTGAAAAAGATAATCCAGACGTGAAGCATTTACGTGGATTCGATGCGTTGGAACGTGTGAAAGCAACTGTTG
AAGCTTCCTGTCCCAGGAAAATCTCGTGCGCGGACACTCTAACTCTGATGACTAAATTCGCAGTTATAAAG
TCTGGAGGTCCTGAGATCGATTTTAACTTGGGGCGATTGGATGGATTTT
CTTCAAATCTGGAGCTCGCAAAATTGCTTACCCCTCGCCATTTTTCTACTGCGACAGCACTACTCAACATTTTTTTTCTTTTAGGCCTGAGTCAAGTTGACTTGGTTGCTCTCTCAG
GCG
CACACACCATTGGCGTCGCACATTGCGAGTCAGTTCGCACCCGCATTTATCCCACCATCGATACAAAGTACGAACCTCAATTTGGAATCTCTGTGAGAAAAAGCTGCCCCATCGTGGACC
CAAGCCAGAATCCTCCCCTTTTGGATCCCAACGCCACCCTAAAATTAGACCAAACGAGCACGGTTTTTGACAACAGTTACTTTCAGGGATTGAGGTCGAACCGGGGATTAATGACTTCAG
ACAACAATTTGAATGCTGATCCCAG
ACTCAATTCCCAAGTGGCGAAGTTTGCATCCAATCAGTCTGCGTTTTTCAACCAATTTAGACTGAGCATGAAAAAGTTGAGCGAAATTAATTTGA
GATCGGTGGGCAATGTCAGAAGAAAGTGTTACAAATTGAATTAA

Retrieve as FASTA