Entry information : PabPrx212(PAB00058958 / MA_87008g0010)
Entry ID 12738
Creation 2013-12-19 (Qiang Li)
Last sequence changes 2017-06-09 (Justine Latour)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2021-01-18 (Christophe Dunand)
Peroxidase information: PabPrx212(PAB00058958 / MA_87008g0010)
Name PabPrx212(PAB00058958 / MA_87008g0010)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Pinaceae Picea
Organism Picea abies (Norway spruce)    [TaxId: 3329 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PabPrx212
S start..stop
PabPrx159 656 0 1..339 1..339
PabPrx74 639 0 1..339 1..333
PabPrx170 596 0 1..339 1..339
PtaPrx92 585 0 1..339 1..340
Literature and cross-references PabPrx212(PAB00058958 / MA_87008g0010)
Protein sequence: PabPrx212(PAB00058958 / MA_87008g0010)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339
PWM (Da):   %s   36577.66 Transmb domain:   %s   o15-37i
PI (pH):   %s   8.72
Sequence 0
Send to BLAST
Send to Peroxiscan
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2

Retrieve as FASTA  
Remarks Complete sequence from genomic. Inorrect prediction : repeated sequence : gcagtgttaatactagcagtgttatatcctcctttaatagtagcgaat in 5'
Send to BLAST
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2

Retrieve as FASTA  
Send to BLAST
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2

Retrieve as FASTA