Entry information : PabPrx91(PAB00019288 / MA_114903g0010) 
                                
                                | Entry ID | 12817 | 
|---|---|
| Creation | 2013-12-19 (Qiang Li) | 
| Last sequence changes | 2017-06-09 (Justine Latour) | 
| Sequence status | complete | 
| Reviewer | Not yet reviewed | 
| Last annotation changes | 2021-01-18 (Christophe Dunand) | 
                                    Peroxidase information: PabPrx91(PAB00019288 / MA_114903g0010)
                                
                                | Name | PabPrx91(PAB00019288 / MA_114903g0010) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Class | Class III peroxidase [Orthogroup: Prx018] | |||||||||||||||||||||||||
| Taxonomy | Eukaryota Viridiplantae Streptophyta Pinaceae Picea | |||||||||||||||||||||||||
| Organism | Picea abies (Norway spruce) [TaxId: 3329 ] | |||||||||||||||||||||||||
| Cellular localisation | N/D | |||||||||||||||||||||||||
| Tissue type | N/D | |||||||||||||||||||||||||
| Inducer | N/D | |||||||||||||||||||||||||
| Repressor | N/D | |||||||||||||||||||||||||
| Best BLASTp hits | 
 | 
                                Literature and cross-references PabPrx91(PAB00019288 / MA_114903g0010)
                            
                               
                                    Protein sequence: PabPrx91(PAB00019288 / MA_114903g0010)
                                
                              | Sequence Properties first value : protein second value (mature protein) | 
 | ||||||||||||
| Sequence Send to BLAST Send to Peroxiscan | 
 | ||||||||||||
| Remarks | Complete sequence from genomic. Correct prediction : modified from congenie.org (5' unfounded, frame shift just after"VAKAV", repetition of 2 sequences = suppression : GAACGGATTAAAGGTGGGTTACTACCGTCATACGTGCCCCGAGG ggaggtgattgtaagtgtagttgtggcgaaagccgtgatagcaaatcctggcgttgcaccttctcttatcaggatgcatttccatgactgctttgtcaga) | ||||||||||||
| DNA ► Send to BLAST | 
 | ||||||||||||
| CDS► Send to BLAST | 
 | ||||||||||||

