Entry information : PabPrx91(PAB00019288 / MA_114903g0010)
Entry ID 12817
Creation 2013-12-19 (Qiang Li)
Last sequence changes 2017-06-09 (Justine Latour)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2021-01-18 (Christophe Dunand)
Peroxidase information: PabPrx91(PAB00019288 / MA_114903g0010)
Name PabPrx91(PAB00019288 / MA_114903g0010)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Pinaceae Picea
Organism Picea abies (Norway spruce)    [TaxId: 3329 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PabPrx91
S start..stop
PabPrx170 628 0 1..339 1..339
PtaPrx92 562 0 1..339 1..340
PabPrx159 558 0 1..339 1..339
PtaPrx89 555 0 1..339 1..343
Literature and cross-references PabPrx91(PAB00019288 / MA_114903g0010)
Protein sequence: PabPrx91(PAB00019288 / MA_114903g0010)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339
PWM (Da):   %s   36618.4  
PI (pH):   %s   5.62
Send to BLAST
Send to Peroxiscan
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction : modified from congenie.org (5' unfounded, frame shift just after"VAKAV", repetition of 2 sequences = suppression : GAACGGATTAAAGGTGGGTTACTACCGTCATACGTGCCCCGAGG
Send to BLAST
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2

Retrieve as FASTA  
Send to BLAST
.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2

Retrieve as FASTA