Entry information : SpolAPx02 (Spipo0G0091000)
Entry ID 13207
Creation 2015-06-09 (Christophe Dunand)
Last sequence changes 2015-06-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-06-17 (Christophe Dunand)
Peroxidase information: SpolAPx02 (Spipo0G0091000)
Name (synonym) SpolAPx02 (Spipo0G0091000)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Araceae Spirodela
Organism Spirodela polyrhiza (great duckweed)    [TaxId: 29656 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpolAPx02
start..stop
S start..stop
VvAPx06 640 0 59..435 42..424
GmAPx07 640 0 22..435 19..432
VuAPx03-2 636 0 70..435 45..412
InAPx06 636 0 22..435 8..423
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6722382..6722600 219 N° 2 6722722..6722859 138 N° 3 6723382..6723502 121 N° 4 6723572..6723672 101
N° 5 6723751..6723838 88 N° 6 6724084..6724151 68 N° 7 6724250..6724336 87 N° 8 6724561..6724635 75
N° 9 6724725..6724802 78 N° 10 6724934..6725038 105 N° 11 6725147..6725221 75 N° 12 6725366..6725518 153
join(6722382..6722600,6722722..6722859,6723382..6723502,6723572..6723672,6723751 ..6723838,6724084..6724151,6724250..6724336,6724561..6724635,6724725..6724802,67 24934..6725038,6725147..6725221,6725366..6725518)


exon

Literature and cross-references SpolAPx02 (Spipo0G0091000)
Protein sequence: SpolAPx02 (Spipo0G0091000)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   435
PWM (Da):   %s   46729.93 Transmb domain:   %s   o415-434i
PI (pH):   %s   8.67
Sequence 476
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAILPSPASISGLGASLAGPSAAAAGGAVSSRRAVTLSSLLLSPRCSALPSSSRRISLKGSPFSPLRLHSQKNARGGAVRKSSGAASATSFASDPGQLKSAREDIKELLRTKFCHPIMIRLGWHDSGTYDKNIEEWPKRGGADGSLRFEPELRHGANAGLINALNLLQPIKDKYPGVTYADLFQLASATAIEEAGGPKIPMKYGRVDVTDPEQCPEEGKLPDAGPPSPASHLRQVFYRMGLGDKEIVALSGAHTLGRSRPERSGWGKPETKYTKDGPGAPGGQSWTVQWLKFDNSYFKDIKEKKDEDLLVLPTDAALFDDPSFKVYAEKYAEDQEAFFKDYAEAHAKLSDLGAKFDPPEGFSIDDDPKEAKPEKFVAAKYSSGNRELSNSMKQKIRAEYEAIGGSPDKPLQSNYFLNIMIFIAGLALLTSLLGN

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns). Incorrect prediction from Phytozome (missing first exon, extra exon).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCATCATCGT ATGTCTGTGC TGGCGATGCA TCATCAGGAC CTTGTCCGGT ACCGACGTTT CCCTTCGGAG GAGCTTCTTC ATGAAAATCT GCTGTCTGAT CGTCACCCAT TTTTTGGTCC  GTAGAAGTCT CGGAACTTCT CTCACCCCAA GAATCGTTAT TATTGGTGGC ACCTTCAGCT TTCGTTTCAC CTTCTGGCAC AACGCCAGAA CTATCCTCGA ATGGCATATC GGTCTGAACT  TGGCTTTTAG CATCAGATTT GGTCTCAGAA ATAGATATAT CGACTGGAAC CACTGCTGAC GATGTCATCA TCCAGATCCC AACCAGGCAA AGACCAACAA ACAAAACGAG GGTCGCTGTT  GAACAGTAGG AGGAAGAAGA AGGCCTCCTA CCCTCCGTAC GGGGGTTTCT TCCTAGCGCC ATCTTTCTGT ATTCAGTGTC CCCCCAAAAC AGTACAGACA GCTGCAAAAG AGGAATTGGA  AATAACATAT GCATTCAATA AATCCGTTCT ACAAGATAAA CGAGATCCCC GTGCAAAAAC AGGAGAGAGA ATTTTTTTAT AGAAAAATGT CGAGCTGCAA TCATCAAGGA ATCACAAGCT  GGAGGTCGAA ACTGAGAAAG TCAATTACTC TCCAAATTTC TCCAGACAGA CGGTACAAAA TAAAGGAAAA TGCACGATAA AAATAGGAAA ATAGAAAGGC AAGACAAACC TAAAAACTTC  AGAGACGTGA GAGGGAGAAA CACACTGCAC AACCGATCAC ACCGGCATCA TGTCACACCT CAACGCGGCT GTCACAACAA AAGCACGAAA TACGGCACAG ATATACACAA TGCAGCTCAG  CAAGCGACAC CATTTGCTCC CAAAAACGCG TCATAAGGCA AATATATGGA CAATGCAGCT CCGGAGGCGA CACCATATGC TTCCAAAAGC ACCATGTCAG GGATGGACCG CCACAGAAGA  TCAGGAAACA AACTTCAATA AGCCTCAATC AGTCACCGGA TGAGATACGA CAATGGCGCG ACACAGCGCC ACAATGCAGC GCCACAACGA GAAAAACCAC CCGACATTAA ACGAAAGCGC  GTAACAAGGC AAAGACATAC GCAATGCAGC TCAGCAAGCG ACACCATCTG CTCCCGAAAG CACCGTACCA GGGACGGACC GGGACAGAAG ATCACGAATC AAACCTCAAC ACCCCTCGAT  CAGTCACCGG ATGAGACACA GCAATGGCGA CGAGAAAAAC CACCAAACAT TCAGACCTAA AGCAGATTCC CCCCCGTACC TTGCTTCAGC TTCAAGCTCC CCGCCGCGCG AGCTCCCTCC  TCCTCCTACC GCCACCACCC GAGATGAGAT CGACGAGATG ATCCAAGATC GAGGAATCGC GAATCCGAGG ATCGCAATTC CACCTCTTTA TTGCAGGAAC AGGCGCCACC TCGCCGCCCC  TCCGACGGTG GCAATCACTC CGCCGGCCGC GATTTCCTGA GAGCGGAGGA GGAGAGCCTG TAATGGCTGT TCATCCACAA GAGCCCCCGC TTTTGTAGGC CATCTTCCCC TGTCCCTCGC  CCACACCCTA ATCAGCACCC ACGGAGGCTT CGCCACGTAA GAGACCCCCG GGTTATCTTT GTTTTTATTC ATGGTCGTAC GGTAGGGTAA ACAGTTCCTA AGGAACACCA ATTTGCGTCC  TCGCGGGGAG CAGAGCTCAC GATACGGACG GACCGGGGTC TCCGCGGGCT GTCCGAGCCG GCCCCACGGA AAGATTCGGC CCAGCCCGAA AACGTAGGGC CCGGCCACGT GTGCTGACAG  AGCAACAAAA GATCGTGGTC CACGTCAGAC AGAAAAGCCC GCCCGATAGA GCGACATGTC AACGGTTATC TGATACGTGT CTATTTGCTA TTCGTTTATC AAGGATTGGT CTCACGGCGA 
GGAACAATAG CCGTTGACGG CGCTTTTTAA GGCCCAGGAC AGAGAGCGCG ATCTTATGAG CAGGAGTCTC AGATCGAACC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGCGATTCTGCCCTCACCGGCCTCCATCTCCGGCCTCGGGGCCTCCCTGGCCGGGCCCTCCGCCGCCGCAGCCGGCGGCGCCGTTTCGTCGAGGAGGGCGGTGACGTTGTCGTCCC
TTCTTCTGTCGCCGCGATGCTCCGCCCTCCCCTCTTCCTCTCGCCGCATCTCACTCAAGGGATCTCCATTTTCCCCTCTCCGCCTCCACTCCCAGAAG
GTAATTTCGCTCGCTTTTCATT
GCTTTGATGCGACTGATTACGGGCTGTGTGCGTGGTGGATGGGAAGTTTCCTCGATTGCCTGCGAAATTTTGAGCTCAGATGGGGTTTTCCGTTCGTAGAATGCGCGCGGCGGGGCGGTG
CGCAAGTCGTCGGGGGCCGCCTCCGCCACGTCCTTCGCGTCGGATCCTGGCCAGTTGAAGAGCGCGAGAGAGGACATCAAGGAGCTCCTCAGGACGAAATTCTGCCATCCCATCATG
GTA
GCCCCCCTCAAATCCGTGCACCTCCAAAGACGGCTTCGTCTAGGGTTTCCCCTCTCCGTTTTTTCACCGAGTTGTGTATTTCAATCGTTTGCTTGGTCGTGATAGATTTCAAATGTTTTC
TCCTCTTTGACTTATCGCGATGGACCAACGATTCTTCCAAATGTTAGTGCGAATATTATGAATTTGAATGAAACCCTATTTAATGGCTAACCACGAAGAGAAATCTGGACAAGACGTAGA
AAAACAGTGAAACAATGTTTCTTGATCTTATGCGGGAAGAACATCGTCTGAGCGTGTTGTCTGCGGCTATTATACTGCATTCGGTAGTTTTCCTCGGCAAAATTATGATCCGGTTTATAC
ATGAACGGAGCATACGGTCCTTCATGCTGGTTCTTCGTATGATATTTTCTTTGATAGTTCGAACGAAATTTAGATCGTAGACAATTTTCCATTAGAATACACTGCAGGTGATTTGATTGT
TTTCGATTGAGTAACTCTGGCTCTTCATCTTCGCATTAGATTCGGCTTGGATGGCACGATTCTGGAACCTACGACAAGAACATTGAAGAGTGGCCCAAAAGAGGCGGAGCAGATGGAAGC
CTGAGATTCGAGCCAGAGCTGAGGCATGGAGCTAACGCCG
GTACCTTTCCTGCCCCAATCCCACTCCAACCTGCCGACTAAGTTTCCATGTACTGACGAGGTGCCGCAGGTCTCATAAAC
GCCTTAAATCTTCTTCAGCCTATCAAGGATAAGTACCCTGGAGTTACATACGCAGACCTGTTCCAATTAGCCAGCGCCACAGCGATCGAG
GTTCTTGTTCAATCATATTTACTTTATCTA
CGAATTGGCGCAGAAGACATTGATAACTGATGTGAAATTAGATTTTAGGAAGCCGGCGGCCCGAAAATCCCCATGAAATATGGTCGCGTGGATGTCACTGACCCCGAGCAGTGCCCTGAA
GAGGGGAAGCTTCCTG
GTGAGAAATATCATACGCCTCTGCAACAAGTATTTTAGGATCTCCTTCCATGTTATTTCTCTGAATTCTTGACCCTCATCTCAACTGGAAACATTGCTCCATCC
CTTTATTTTTTATTTTAAAAATTATTTTTTTGGGTACGATCTTCTTTGTCACCATATAATTGTGATCTCAGTTTCGGACTTTCAGAGAATTCCTTGCGTAATTCCCTGCATTAAGGGTTT
ATAGTCTTCTGAATTTCGTAGATGCTGGCCCACCTTCTCCAGCCTCCCATTTACGGCAAGTGTTCTACAGGATGGGCCTCGGTGACAAGGTCAGCACCCGCAGCACAGTCCATATTTATT
CATCACACGGACGTCTGATTCTTCATGACGAGCTTATAATTTCGGGGTCACCTGTCGGTCCTTGCAGGAAATAGTCGCATTGTCCGGTGCCCATACTCTGGGAAGATCAAGACCCGAACG
CAGTGGGTGGGGCAAGCCAGAGACCAAGTATACA
GTAAGGATAAATCCCATCTCCAAGATTTGTTTCCATTCTTATTTTTATTTCTATTTTTATTTTATTTCGTGGCGTTGATCTCCTCA
TCCAATAGCATAAATAAAAACACTGTGGATTGCTGGTGTGCGTTGACCGTCCCCCTCTTCATTTCTCTTCCATTGAAGCCCCCCCCCTCATCCTTCATCTGGTGTAGTTATGCGGTCAAA
CTCTGTGATTCTTGACAGAAAGATGGGCCGGGCGCCCCCGGAGGTCAATCGTGGACTGTGCAGTGGTTGAAGTTTGACAACAGCTACTTCAAGGTGGGGAATCTTTTTATCTGGCCTCTG
AATGATTTATTTATTTATGTATTATTATTATTATTATTTTTTCTTCCAAACTTGTCATTCAGGATATCAAAGAGAAGAAGGACGAAGATCTGCTGGTGCTGCCCACCGACGCTGCTCTAT
TTGACGACCCATCCTTCAAG
GTAACCGAGATTCTTGGACTGCATATAGATTAAGAAAAATAAAAAAACTCATAAAAAGATAAAGAAATTCAGAAAAAAAAAATTAAGAAAAAGAAAACGA
ATTAAGAAAAAAAAATGGTCTTCTTCTTCAGGTGTATGCTGAGAAGTATGCCGAAGATCAGGAGGCATTCTTCAAGGATTATGCAGAGGCCCACGCAAAGCTCAGCGATCTTGGCGCAAA
ATTCGATCCTCCCGAG
GTGCGTTCTCCGAAAATATGAAAAATATTCCTCCTGAGAGCGGGAAATTTTCTGTAATTCGCGTCTCCCTTCCCTAAAATAATCCCAATTATGGAAATTATTCG
GCAGGGTTTCTCCATAGATGACGATCCCAAGGAAGCCAAGCCGGAGAAGTTCGTCGCCGCCAAGTACTCCTCCGGAAATGTCAGTCATACCCTCATTTTTATCCCCTGACTCTGGTTAAA
TAATTTACAGATGCATATATAATTTATAAATATTTAATATGGTAGAGAGAGAGAGAGAGAGAGAGAGAGAGTGGAGGATCTAATATGATGCTCTGAATGGCAGAGGGAGCTGTCGAACTC
GATGAAGCAGAAGATTCGGGCAGAGTACGAGGCGATCGGGGGGAGCCCTGACAAGCCGCTCCAGTCAAACTACTTCCTCAACATCATGATCTTCATCGCCGGATTGGCCCTGTTGACTTC
TCTTCTTGGGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGCGATTCTGCCCTCACCGGCCTCCATCTCCGGCCTCGGGGCCTCCCTGGCCGGGCCCTCCGCCGCCGCAGCCGGCGGCGCCGTTTCGTCGAGGAGGGCGGTGACGTTGTCGTCCC
TTCTTCTGTCGCCGCGATGCTCCGCCCTCCCCTCTTCCTCTCGCCGCATCTCACTCAAGGGATCTCCATTTTCCCCTCTCCGCCTCCACTCCCAGAAG
AATGCGCGCGGCGGGGCGGTGC
GCAAGTCGTCGGGGGCCGCCTCCGCCACGTCCTTCGCGTCGGATCCTGGCCAGTTGAAGAGCGCGAGAGAGGACATCAAGGAGCTCCTCAGGACGAAATTCTGCCATCCCATCATG
ATTC
GGCTTGGATGGCACGATTCTGGAACCTACGACAAGAACATTGAAGAGTGGCCCAAAAGAGGCGGAGCAGATGGAAGCCTGAGATTCGAGCCAGAGCTGAGGCATGGAGCTAACGCCG
GTC
TCATAAACGCCTTAAATCTTCTTCAGCCTATCAAGGATAAGTACCCTGGAGTTACATACGCAGACCTGTTCCAATTAGCCAGCGCCACAGCGATCGAG
GAAGCCGGCGGCCCGAAAATCC
CCATGAAATATGGTCGCGTGGATGTCACTGACCCCGAGCAGTGCCCTGAAGAGGGGAAGCTTCCTG
ATGCTGGCCCACCTTCTCCAGCCTCCCATTTACGGCAAGTGTTCTACAGGATGG
GCCTCGGTGACAAG
GAAATAGTCGCATTGTCCGGTGCCCATACTCTGGGAAGATCAAGACCCGAACGCAGTGGGTGGGGCAAGCCAGAGACCAAGTATACAAAAGATGGGCCGGGCGCCC
CCGGAGGTCAATCGTGGACTGTGCAGTGGTTGAAGTTTGACAACAGCTACTTCAAG
GATATCAAAGAGAAGAAGGACGAAGATCTGCTGGTGCTGCCCACCGACGCTGCTCTATTTGACG
ACCCATCCTTCAAG
GTGTATGCTGAGAAGTATGCCGAAGATCAGGAGGCATTCTTCAAGGATTATGCAGAGGCCCACGCAAAGCTCAGCGATCTTGGCGCAAAATTCGATCCTCCCGAGG
GTTTCTCCATAGATGACGATCCCAAGGAAGCCAAGCCGGAGAAGTTCGTCGCCGCCAAGTACTCCTCCGGAAAT
AGGGAGCTGTCGAACTCGATGAAGCAGAAGATTCGGGCAGAGTACG
AGGCGATCGGGGGGAGCCCTGACAAGCCGCTCCAGTCAAACTACTTCCTCAACATCATGATCTTCATCGCCGGATTGGCCCTGTTGACTTCTCTTCTTGGGAACTGA

Retrieve as FASTA