Entry information : GtNAnPrx01
Entry ID 13355
Creation 2015-08-04 (Christophe Dunand)
Last sequence changes 2015-08-04 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-10 (Achraf Jemmat)
Peroxidase information: GtNAnPrx01
Name GtNAnPrx01
Class Other non animal peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Cryptophyta Geminigeraceae Guillardia
Organism Guillardia theta    [TaxId: 55529 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GtNAnPrx01
start..stop
S start..stop
EsilNAnPrx 163 5e-47 59..394 64..377
CmeAPx02 116 5e-29 44..388 67..452
CsaAPx-R 77 4e-16 59..388 50..312
ZmaAPx-R 77 6e-16 53..249 104..299
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..179 179 N° 2 236..639 404 N° 3 702..919 218 N° 4 962..1127 166
N° 5 1179..1290 112 N° 6 1335..1440 106  
join(1..179,236..639,702..919,962..1127,1179..1290,1335..1440)


exon

Literature and cross-references GtNAnPrx01
Literature Curtis,B.A. et al., DOE Joint Genome Institute. Algal nuclear genomes reveal evolutionary mosaicism and fate of nucleomorphs. Nature (2012) In pres
Protein ref. GenBank:   XP_005831559.1
DNA ref. GenBank:   NW_005434635.1 (27109..28548) JGI genome:   scaffold_39 (270989..28548)
EST ref. GenBank:   HE989018.1 [5' end]
Cluster/Prediction ref. JGI gene:   152902
Protein sequence: GtNAnPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   395 (376)
PWM (Da):   %s   42187.36 (40233.4)  
PI (pH):   %s   8.55 (8.66) Peptide Signal:   %s   cut: 19 range:19-394
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVAQMALALLHVASTCAFMAPVSSPCRSLEASRTMSHNRAAARQILRMSTESSHVEARRTFLKSALTLPLTLAVGQRAGAEVFFDTERYGDKELKVSTINKVKQQFRALYEKKPELLVPLFRLAMEDALSFDAGTRENGPDGSVLQRVGGPGSEYLKEAAEEVRRIKSELNRQTQLTSADIIAFAGAVAIEATGGPRTVVQLGRADGKPSSKSGMSSWDFSAPTAEGILGAMSKSGLTAKEAVLLAGAIGSLNQASLNMKEAIANKVVCDVEDPSCTSEEEGYYGLYSPVTIRSETSNLYGKNRGASAVNSNTGFDSARIAGLAGDAKFSNKFLIDAASGKSDDPLAKALMSDKEMSKWVMEYGKKGNNNKFVKDCEKCYVALTELGRSNTSR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAGTGGCACAGATGGCGCTTGCGCTGCTTCACGTGGCCTCGACCTGCGCGTTCATGGCGCCTGTCTCTTCGCCATGCCGGAGTCTTGAAGCCTCTAGAACCATGTCTCACAACAGA
GCTGCGGCTCGACAGATCCTCAGGATGTCGACAGAGTCTTCGCACGTCGAAGCCCGAAG
GTCGTAACTTATCGATGCCTCACCGCTGCCTCGTTGCTGACTCTTCAGCACTGCAGGACCT
TCTTGAAGTCTGCACTGACACTTCCACTCACTCTCGCTGTCGGTCAACGGGCTGGAGCTGAAGTGTTCTTTGACACGGAGAGATACGGAGATAAGGAGTTGAAAGTTTCCACTATCAACA
AGGTGAAACAGCAGTTTCGGGCCCTGTATGAGAAGAAACCAGAGCTTCTGGTCCCATTGTTTCGCCTTGCCATGGAAGACGCTCTCTCCTTCGATGCCGGAACCAGGGAGAACGGCCCCG
ATGGCTCAGTGTTGCAACGGGTTGGAGGGCCGGGAAGCGAGTACCTCAAGGAAGCTGCGGAAGAAGTTCGACGAATCAAGAGCGAGCTGAACAGACAGACCCAACTCACATCTGCTGATA
TCATTGCCTTTGCTGGTGCAGTGGCGATCGAAGCTACAG
GTAAGAGCAGTAGTTTCTCCTCCTTGCAGTGCCTCTATGACATTCTGAATTTCCTGATGAAGGTGGCCCGAGGACCGTGGT
TCAACTTGGACGTGCGGACGGTAAGCCGAGCTCGAAGAGCGGGATGTCTTCATGGGACTTCTCGGCTCCAACGGCTGAAGGAATCCTTGGAGCCATGTCCAAGAGCGGGTTGACTGCTAA
GGAAGCAGTGCTGCTGGCTGGAGCCATCGGTTCCTTGAACCAAGCAAGCCTCAACATGAAGGAGGCCATCGCTAACAAG
GTGCCTGTCTAGTATGCCTGTGGTGAAAGTGACGGGAACAA
GGTTGTCTGCGATGTGGAAGATCCTTCCTGCACGTCAGAGGAAGAAGGGTACTACGGACTTTACTCCCCCGTCACCATCAGATCTGAGACGAGCAACCTTTACGGCAAGAATCGAGGTGC
TAGTGCTGTGAACTCAAACACAGGGTTCGACTCCGCCAGAATCGCCG
GTTTCTTCCTCCCTTGCTCGAAGTCGCTGTTTATTCACCATGAGTGCGCAGGGTTGGCGGGTGACGCCAAATT
TAGCAACAAGTTCCTGATAGATGCAGCAAGCGGCAAGTCGGACGATCCTCTGGCCAAGGCTCTTATGTCGGATAAGGAGATGAGCAAATG
GTACCTGACTTGTTGGAGCAGTTCAGACCT
GATGGCATGTGCAGGGTGATGGAGTATGGCAAGAAGGGGAACAACAACAAGTTCGTGAAGGACTGCGAGAAATGCTATGTTGCTCTCACGGAGTTGGGCCGTTCTAACACGAGCAGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAGTGGCACAGATGGCGCTTGCGCTGCTTCACGTGGCCTCGACCTGCGCGTTCATGGCGCCTGTCTCTTCGCCATGCCGGAGTCTTGAAGCCTCTAGAACCATGTCTCACAACAGA
GCTGCGGCTCGACAGATCCTCAGGATGTCGACAGAGTCTTCGCACGTCGAAGCCCGAAG
GACCTTCTTGAAGTCTGCACTGACACTTCCACTCACTCTCGCTGTCGGTCAACGGGCTGGA
GCTGAAGTGTTCTTTGACACGGAGAGATACGGAGATAAGGAGTTGAAAGTTTCCACTATCAACAAGGTGAAACAGCAGTTTCGGGCCCTGTATGAGAAGAAACCAGAGCTTCTGGTCCCA
TTGTTTCGCCTTGCCATGGAAGACGCTCTCTCCTTCGATGCCGGAACCAGGGAGAACGGCCCCGATGGCTCAGTGTTGCAACGGGTTGGAGGGCCGGGAAGCGAGTACCTCAAGGAAGCT
GCGGAAGAAGTTCGACGAATCAAGAGCGAGCTGAACAGACAGACCCAACTCACATCTGCTGATATCATTGCCTTTGCTGGTGCAGTGGCGATCGAAGCTACAG
GTGGCCCGAGGACCGTG
GTTCAACTTGGACGTGCGGACGGTAAGCCGAGCTCGAAGAGCGGGATGTCTTCATGGGACTTCTCGGCTCCAACGGCTGAAGGAATCCTTGGAGCCATGTCCAAGAGCGGGTTGACTGCT
AAGGAAGCAGTGCTGCTGGCTGGAGCCATCGGTTCCTTGAACCAAGCAAGCCTCAACATGAAGGAGGCCATCGCTAACAAG
GTTGTCTGCGATGTGGAAGATCCTTCCTGCACGTCAGAG
GAAGAAGGGTACTACGGACTTTACTCCCCCGTCACCATCAGATCTGAGACGAGCAACCTTTACGGCAAGAATCGAGGTGCTAGTGCTGTGAACTCAAACACAGGGTTCGACTCCGCCAGA
ATCGCCG
GGTTGGCGGGTGACGCCAAATTTAGCAACAAGTTCCTGATAGATGCAGCAAGCGGCAAGTCGGACGATCCTCTGGCCAAGGCTCTTATGTCGGATAAGGAGATGAGCAAATGG
GTGATGGAGTATGGCAAGAAGGGGAACAACAACAAGTTCGTGAAGGACTGCGAGAAATGCTATGTTGCTCTCACGGAGTTGGGCCGTTCTAACACGAGCAGATGA

Retrieve as FASTA