Entry information : EsilCP03(Esi_0043_0035)
Entry ID 13394
Creation 2014-11-19 (Bruno Savelli)
Last sequence changes 2015-08-05 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2021-01-29 (Christophe Dunand)
Peroxidase information: EsilCP03(Esi_0043_0035)
Name EsilCP03(Esi_0043_0035)
Class Catalase peroxidase    [Orthogroup: CP002]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EsilCP03
start..stop
S start..stop
EsilCP04 870 0 63..564 1..503
EsilCP02 714 0 63..566 1..509
EsilCP02 95 2e-20 148..250 457..554
EsilCP02 50 0.000001 557..590 575..607
EsilCP01 714 0 63..565 1..508
EsilCP01 97 4e-21 148..240 457..545
EsilCP01 48 0.000006 557..590 576..608
EsilCP05 630 0 63..565 1..464
EsilCP05 97 3e-21 148..250 413..511
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 156092..156259 168 N° 2 155339..155449 111 N° 3 153214..153418 205 N° 4 152712..152809 98
N° 5 152374..152559 186 N° 6 151517..151601 85 N° 7 151206..151325 120 N° 8 150503..150666 164
N° 9 149814..149975 162 N° 10 148947..149023 77 N° 11 148189..148492 304 N° 12 147162..147255 94
N° 13 146235..146353 119  
complement(join(146235..146353,147162..147255,148189..148492,148947..149023,1498 14..149975,150503..150666,151206..151325,151517..151601,152374..152559,152712..1 52809,153214..153418,155339..155449,156092..156259))


exon

Literature and cross-references EsilCP03(Esi_0043_0035)
Literature Cock,J.M. et al., The Ectocarpus genome and the independent evolution of multicellularity in brown algae. Nature 465 (7298), 617-621 (2010)
Protein ref. GenBank:   CBN74802.1 UniProtKB:   D8LN39
DNA ref. GenBank:   FN648630.1 (156259..146235)
Protein sequence: EsilCP03(Esi_0043_0035)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   630
PWM (Da):   %s   67981.75  
PI (pH):   %s   4.53
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGADLSTRPADILSHLAHSCSPPRSSHNEATRNGDIELALLEPRARSNRGVHQVRKVCFETNMGRTCNLVWLAGFALVARTASGGCPFLSGQKDLGSRIGGERLLSGDHDDGHEGGADYSRETYEAIQADIVSMFVDSKDFWPADFGNYGPLFIRLAWHCAGSYRASDGRGGCDGGRIRFFPEHGWADNTNLDKALTLLQPIKLKYGDAISWADLITLTGDMAISSMGGPILGFCAGRQDDDSGYDSLELGPTPEQEATAPCAVNGTCELPLGTSTVGLIYVNGGPMGVPDPEASAPQIREVFSRMGMNDTETVALIGGGHAFGKVHGACPSGPGPDPFDAPEAPWPGTCGDPDSATFGRAENTFTSGFEGAWTEEPVWDNSYFVDLLEYDWIQAESPAGNIQWIPVLKEDATETDVPDIIMLTSDVALLMDPEYLAIVEEFAADQYALDIAFSNAWYKLVTRDMGPHSRCVGTDVPPPQEFQLPLADTPKDLPSYSGAKEAIGRILSEESTYAPLFVTLAYQCASTFRSTDYMGGCNGARIRFPPQSEWASNAGLSVAQMVALAGRPRSSSFMTGLGYSGSYTEDDAGHPWRHLCDYNGFRLSTPRSIRRRLRQGRVRLPFLHISL

Retrieve as FASTA  
Remarks Complete sequence from genomic (12 introns). No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGCGGACCTCTCCACTCGCCCCGCCGACATCCTGTCGCACCTCGCACACTCCTGCTCTCCCCCTCGTTCCTCACACAACGAGGCAACACGCAACGGGGATATCGAGCTTGCTCTT
CTTGAACCCCGGGCAAGAAGCAACAGAGGCGTTCACCAAGTGCGCAAG
GTATGCAGCGGCCAAGGGTGCCGGGTTGTGTGCGGGTAATGTCGGAGATTCGCCAGAAGATGTACCGGCCCC
TTTTCGCCCTTTTCGGACAAAACAACGATATGATGAACAGGATTGTAAAAACGTAGAGCGCACTGGGGTCAAGTTCGTCCTCAATTTCATTCATTCCTCGCCGCCGCTCTGAACAGGGCG
CAAGACGAGGAAGGCTTCGGCCTTCCCCGTTTTCATGCGCGATAGAGGACATTGCCTGCTCTACTGCGGAGCCTATACTCTTGTCTGTGGCATGTGGAATGGTGCCGTTTGTCTCGCCGT
CTTTGTTGGTCTTTCATGATTCTATTTATCCGCTTTGGCACGCTGGAGATTTCTACTCGATCAAACCGCCGCTTCTGCGTGTGAGAGGGCCAGGCTATGTACGCGACCGTTTCTGGATTT
ATCCACACGCATTTGCGTCTCTTCTGTCTGTCTGTCTGAAGATGATAGCAACAGCAACAACAAAACGCAGAACGCCAGAAGGAATCTTCATTTATTATTTGCGTCGTTGTTTTTCTTCGT
TTGCTCCTCATCGACTTTTATCATTTAATTTTCTGCCGCATGAATCCACCAACAACGAACAAACCCTGTACTGCTGCTGCTGCACTGTAGGTCTGCTTCGAAACGAACATGGGACGCACG
TGTAATCTGGTGTGGCTCGCTGGCTTCGCCCTGGTTGCTCGGACTGCTTCCGGTGGATGCCCGTTCCTTTCAGGTCAAAAG
GTGAGAGAGTTGATCGTGTGTGTTTTTTCACAATATTAT
TGCTCGCCGCGCATTCTTTGTTTCTCTTTTACCGCAAGCGAGAGCGCAGTTTATCATCGCCCAGCAGTACATGTACAAGTGGCGGCCTACTCCATAGAAACAAGCACCTCGAGCCAAGGC
TTAAATCCTCACTAATGTACTACTGCTGTTGCATCAAAACGAGGTTTGTGTGTGTCTGTTGTGCCTGCGCCTTTCTGTTTCTTGCTCAACCCAAGAATCTGTGCCTGGGTGGCTTGTTGA
TAACTTGCTTTCTTCTTCCGTCACCGACACAGCAAGCAGCAGTGGGGCCGCAGCAGTGATGCACCTTCCTCCCATGTATGATATGAGATGCACCGTAATGAGATCCGCCGTACACCCGGC
ACTTTTGCGCGGCCACAGCCGTAGCACACCCTCTACCGGACAGCTCTATGAACACACACATCGCAGCTCCCCACGACCTCACATAAATAGCCGTATTTTGGCACCAGGAATCTTCATGCA
GACGTACGTGGTATGGTGGCGATACGGTGACGACAAGTGTTGACTTGTGCTGCTTGACTTTTCGCGGGGAAAAAATCGGCCCCGCATACATACACATAACAGGTCAACAACGTGATGCTA
CATACATCCTGTGAGTTAGACTACGCGTACTTTTTACGTAGAACACGTGATGAAGTGCACGATGTCGTTCCTCTCTGTGCGATAAATTCTACCTCCAAAATACATGAGCAACATCCGTCC
AGGTGGGCGTTGTTTTTTTTTTAGCAGTGCTTACAATCGGGTCCACCCGGTCCAACCGCGGCCATCATCGGGCACCCCTACAAGACGCTGCTGGAAGCGACCGCATGACACCATCTGATT
GGCCGACGCCCACCCCTACCCGACCTTGACTGTCTTTCCACCGGGTGCACCCGATCTTGGCTACTCAACCCCTGGAAGGGTACCCGATTTTTCATTTTCCTTCCCCTACCCCAATTGCCT
ACCCTAAAATGTGGTGGGCTGTCCGGCCAAAACCCAAGCACACACAATCACGTATCGGACGCACACCGCAGGCCGCTCGTTTGTCGCCAATGAGAAAGCGGCGGGAGGCAGAGAGTTATG
TCTATTTTTTAGATGCGTCTCGCGTGTCGAATCTCGTGAGTGAGTGCGGTATCATCCAGCTCTTCTCAATCATTTGCACCGACCGCCTGCCGTTTTCCCCAAGCGAGAGTGCTAGTCGGT
CAAATTAGACCATCCGACTAGTCAGCGCTGACTCGTCGGATGGTCTAATTTTACCGATTTAGTGCCACCGCCGGCGGTGGGTCCGCCCCCATCCGCCGTCGGAACGTCCGAATTCGAGGG
TAGGGCATTGCTTTGCAGACGTGTGCTTGTGTGCATGGGTTCTGATCCAACAGCCCAGCCATTTTCGGGCAGGGGAAAGAAAAACCGTGTACCCCTGCGGAGGGCGAGTAGCCAAGATCG
GGTGCACCCGGTGGAAAGACGGTCAAGGTCGGGTAGGGGCGGGCATCGACCACCAGAGGGTGTCATGCGGTCGCTTCCAGCAGCGTCTTGTAGGGGTGCCCGATGATGGCCGTGTTTGGA
CCTGGTGTACCCGATTTTGGCCAATGCTCCCTTATTTTTCCCCTCTTTCTGGTAATATTCAAGAGCACCCCCTCCCCTGCTTCCTCCGTGTTGCGCTAACACGTTCTCTCGGAACCAAGG
ATATCGTCAAAAAAGGTACACCGCAAGAATGCATTCGGAGCTGACTGCGACCTTCCTACAATGCATAAAGCGAGAAGGAGGGCTGTCGTATGCATACTATGGTTTGCCTTTCGTACACAA
TAAATTCAAGAGAAACAAAACGGAAAACCGCCCGTGCCCCAATACATGCACGTATTATTGGACAATTTACATTAGCGGCAGGACCTTGGCAGCCGCATTGGTGGCGAACGCCTCCTGTCC
GGCGACCACGATGATGGTCACGAAGGAGGGGCCGATTACTCCCGAGAGACGTACGAGGCCATCCAAGCCGACATCGTGTCCATGTTCGTCGACTCCAAGGACTTTTGGCCGGCCGACTTC
GGCAACTACGGCCCTCTGTTCATTCGACTTGCTTGGCACTGTGCAG
GTAGGGACGGACACACGCTTTTGTGCCGTCTTGTGCCGTGTCGCGAAATATATCGGTGACGTAGGTAAACAGGG
GCTTCTTTGTTGATCGCACCCGTAGCCTGTGATGGCTGTAGCTGCCAAACCAAGTGTTGATAGAGGTTCAGAGGTCGTTGTTGGGTTGTTGTCTTTGCGCGAGACATCGTCAAATTACAG
TGCTTATAGTTTACCTCCAGCGAAGAGCGTGTGCTGAAAAGGGCAGCCGAACCAAAAGCCAAAAACAAGCGTCTCCGCCAATGTTCAACCAATGGTTTCGTCTCAATCAAGCGCATCAGT
TTGATGTCAATTTCTACGGAGTGCAGTCAAAGACATCCTCCATACACCTGCCGAAAGCTACGGTCCATCACTGCCTGCGTGCATCCGCAGGTAGCTACCGCGCTTCCGACGGGCGAGGGG
GCTGTGATGGCGGCAGGATCCGCTTCTTCCCGGAACACGGCTGGGCCGACAACACCAACCTGGACAAG
GTAATTACCCCGCCACGCCTCGCAGTCGGCTGATTGCTCGGCGCTTCATGAC
GTTTTCAGAACGGATGAACACTCTCTGGCGAAACTCCGGACACAGTCGACCCCCTCCCCCTCCGCTGCTCGTGGACTTCGGCGGCACCCCCACAAAACAGGCCCTGACCCTCCTCCAGCC
CATCAAGCTCAAGTACGGCGACGCGATCTCATGGGCCGACCTCATCACCCTGACGGGAGACATGGCCATCTCGAGTATGGGGGGTCCCATCCTTGGTTTCTGCGCTGGAAGGCAGGATGA
TGACTCCGGTTACGACAGTCTCGAGCTCGGCCCAACTCCCGAACAG
GCGCGTGGTTCTATTGAGGGGACCGTCCCAAAATATTTCATGTTTTTGGAGCACGACATGCTAATATAAAGCAT
CAGTTATTGGATGGACTGTTTTCGGTGCCGCCCTGGTTTGGGACCCAACAAAGCGGTCCGTGCCCTACGAAAATAGTGCGTTGTTTCGAAGCGTTCTAGTGCTGAGCTACCTTTTGACGC
TGGGCTGCTTGCCGAAACTCGAAACACTAGAGGACCATGATGTCCTCGTCTTGCTGTCTGTTGCGAGCTGACCAAAACCAGCCGGCGATGTCTTCACGTTTTAGTGCGTCCGAGAGTTTG
TCGATATCGCGTGTGTGGTTCTCGATGACCCGTGACCAGCGCTTTAAATAGCCGCGAAGCGGCTGTTGCGGAGCCGCCAGGCTCCCGCAATTTTTTTTGGATATTTACTTCGTTTTGAAA
GGAAATTACGTCAAAAATAGTGTTGTTATTTAATAACGGCGAGAAAAAGGGCCCCAAAAAATGTTTTTCGCCTACGGCGAAATGGACCCCCCCCCAAAAAATATTTCGCCTACGGCGAAC
GTGTTGCGGGCCAAAATGTTCGTTGCGGCAAGCCGCAATATCCATCCAATTGTTGCGCTTCCGCAACTCCGCAACACCTATTTAAAGCGCTGCCCGTGACAACGAAAACAACCCCGTGTT
CTCGACATGTGTGTGTCGATCGACACCCGAATAGTTCTGGTTGGGTGGCAACTCAAATTCCCTGCACAACAATCGTGAACGAAACACACCTCGAGCAGGAGGCGACTGCTCCTTGCGCCG
TGAACGGAACCTGCGAGCTCCCTCTCGGCACCAGCACCGTGGGGCTCATCTACGTCAACCCAG
GTACCATGAAAATTCTGCTGCCCGCGAAGAGACCCATCGTGAATAGTGAACCACCAA
CCGCCGTACGCCATTTTGCACGCGAGCCTTTGAGGACCGTGAAGCGGTAAACAGAGAGTGTTGATGTTTGCACGTTCCGTAAACCTTGACCAGGAGAACCGAAACAAAACTGTGTTCGTT
GCCGTTATTTCCAGGCGGGCCAATGGGCGTCCCTGATCCGGAGGCCAGTGCGCCGCAGATCCGTGAAGTCTTCTCGCGTATGGGCATGAACGACACCGAGACCGTGGCGCTCATCGGCGG
AGGGCACGCGTTCG
GCAAGTCCCCGTAGCCCGCTGCATAGGGTATATCTAGCCTTTGAAGCACCCTTTCCGCTATTTCTTGCCCCCCAAAGCTGCCGTAGACGGCGAGGTAGGCACAAGA
CTTGTCCCGATATTATCGCCTGTCGTTTCATCCCTACGATGTTCGGTTCTCTGATTCTGGTGTCACGTTGCCGACAGGATGATTCACGAGGGCAATGTCACCGACGCATGACGACGCTGA
GGGCATAACCTTGTCGCATCACGTGGAAAACCAATGTTCCGTTACTATTGACGCACTTCTGGCAACCGTGTCCTTCCCCGCACGTGGTGTCTTTGACCTTTCCTTCAACGATTCACTTTC
AAACGTGAATTTTGACTTGACAAAGCAAGATTTACGCAGGTCTGGGATGGCCGCGTCACCTCTCGTTCCCGTAGTTCACTAGCGCCGTCTCTCCCCTCATGACCAATGGCGTGCCTCAGA
TAACCACCCACTACAACCATGATAACCTGCTTGCTCCCACGTACACTGGTCGTCCCCCGCTCGATGTCCACAGGAAAGGTGCACGGGGCATGCCCCAGCGGTCCTGGCCCCGACCCCTTC
GACGCCCCGGAGGCCCCCTGGCCCGGAACCTGCGGGGACCCCGATTCGGCCACGTTCGGGCGCGCCGAGAACACCTTCACCTCCGGCTTTGAGGGGGCTTGGACGGAAGAGCCCACG
GTA
CGCTGCGCGCTTGCTGCGGTACACCGCACCGGTAGTTTGAACGCGGATGGGACAATAAAGGCCTCTCCTCCGGCCTCGAAGACCGAGGGCGGAAGGAGCTACATCTACCAAGGATTGACG
AAACAAGCATGATTGTGTTTAACGGCACAGAGTATTGATTTCTGAAGACGGCGTGTTTGCTCGGGGTGGTGGCATATCCTAGCAGACGTTGCGGACAGCTCATCGGTGTTGAAGAAAAAA
GAAGAGAAAGTTGAACTGAAACTCGGGTGTGCTGCTACTCGTCGGAAGGGAGAACGACGTCTCTATTGCTGGTTTTTATTGTTCGGCGTCGTACAGAGCAATAAGCGCGCACGTGCTCGT
CTGGCATGACCTACGTACGGTTAATTCCCTCCACCAAGTGGTGCCCGGCCCTGAGCGGGCACAACGCCTGACTCCGATTACGTCATGATTCCCGATCCTCTACGCCTCGGCGGTCTCGAT
CGCCTTGTCGCTGATTCTTTCCTCTTCACGCTTCTGTATTGAAGGTATGGGACAACAGTTACTTCGTCGACCTCCTAGAGTATGACTGGATTCAAGCCGAGAGCCCCGCCGGCAACATCC
AGTGGATTCCCGTCCTGAAGGAAGATGCCACCGAAACCGACGTTCCAGACATCATCATGCTGACTTCGGACGTCGCTCTGCTGATG
GTGAGGGCGAAAGACGTTGTTTCGCACACCAGCA
GCCAGCCGGCCAACTGGTTTCTTGACTTTAGGACTTCAACGTGAAACTAATCGTGACGGACGACCCGTGTACCACAATCCAGTGCTTTCTGGTGCATGAAACCTTGTTTGGATGCTCTCG
TCCGTTCGTTGAGTGATACTAGCTCGTCAGAACATATTCTCCGGTGCGTGACTACTGTCCCAAATAATCAGTCTGTGGCGAACCTGAGTGTGTAAATTACAGAATACCACGGCCCACAGC
TTTCCACTCGTGAAAGCTACGGCGAGGCTAGCGCAGCGTTGGCAATGCTATCTACCACTTCACGTGATGGCATTTCGTGCTGCGGGTATGCGCGCAACTAGACACTGCAAACTTGTTCAC
TGTCTCCTCGATTGGCAATAGCCAGGTAGGACTATGCCCCGAACCCATCACACATACATATAGTCTAGGGTTGGTTCGTCAATTTCTCCTCTTCTCTGGGCCGAAGTCTCGTTTTCCTAT
CCAGCCCCTGCCACGAAAACCAACACGGGGCCGTTTGTAAATCTAGAGCCAACGTCTCGTGATGGGAACCCTAGCTCCCACCGTCTGACAACTTCTTCCTTTCCACCCGTCCGCCACCGC
GTACCACCGAAGCAAGCGGGGGAGTGACTTGTGCGAGATATCCCTGAAGCTCCAGCTCAAGCATTTGAATCATGCCGCTTACGTTGTGACAGCGTTTGTCCACGCACCCCGCCCCCCGTT
CTGTGTTGCCCATACAACCTTCGCGCGCCACTGCAGGACCCCGAGTACCTTGCTATCGTGGAAGAGTTCGCCGCCGACCAGTATGCCCTGGACATCGCCTTCTCCAATGCCTGGTAACGC
CCACACGAGGGACTTCAGTGGCACAAAACACACGGAAGCACGTAAATGAAGCATCTGGAACACGTCTTGACCGATTACCACGTGTTACATTCTCGGCTGTTCAGACTGAGCTTGTCCCAA
GACATGTTTTCCAAGGAATCTTATCTGTCTGTGGGTACCAATTTCACAAGCACGAAAGCTACGTATGTAGCCTGAGACTCTGTGGTGGACAGCAGCAAAACTCGACCGCGGTTGCCTTGT
GCGGCTTGGTTTCCAGCTTTCACCCCTTTGGTGATCTACGGAATACATCTTCGTCGACGAGTGATACCACTTGACGCAGTGTCGGAGGAGCAACGCTCCGCCTGACTTTCCAACGGCCAT
GTAGACAAAACTAATTGATGAAATACGAACGTTCCGCTACCGCTTGTTTACTCGTGGGCCTCCGCTGCAACGTTTCCCTCGGGACAGGTACAAGCTCGTCACTCGCGACATGGGGCCGCA
CTCGCGCTGCGTCGGCACCGACGTCCCCCCCCCGCAAGAGTTCCAGCTCCCGCTCGCCGACACGCCGAAGGACCTCCCGAGCTACTCTGGGGCCAAGGAAGCGATCGGCCGCATCCTCTC
GGAGGAGTCGACGTACGCCCCCCTCTTCGTGACCCTGGCCTACCAGTGTGCGTCTACCTTCCGGTCTACCGACTACATGGGAGGCTGCAACGGCGCCAGGATCAGGTTCCCGCCCCAGAG
CGAGTGGGCCAGCAACGCGGGGCTGAGTACG
GTGAGCTAGTCTCGCTTTTGTTCCGTTTGTTGCGAGCGTCGTGCGGGGGTTGAGCGATGTCTCCCTCTCTGCTTTGTTACCGAATGCCG
GGAGGGTGCATCAAACCGCATGTGACTTTTCCTCCCTAGCAATGATGTGTTTTGCCCGAAGTGGTGTAAGAGGTTGCCGACCCGTGGGAGTTGGGAGATAGATCACATTCGGATACATAT
ATCAACCAGGCGTTAGACAAGATTGCTTGGGGACCAAGACACGCGCCGCCTCTCTCTGTGACCTCCTCATCAAGTCCACCCTTCTTCCGTTCGCCCCCCTCCCGCTCCATCCCTTCGCAC
GTCCCAACCATGCTGCTCAGGTGCTGGACCTGCTGCAGCCCGTACAGGATGCTTACCCGGACATCTCCTACGCCGACCTGATCGTCCTGGCCGGCCATGTCTCTCTCAAGCAGGGGGGCT
CTGTCCCCCACCTCTTGTACTGCAAGGGTCGCGTCGACGCGGCGCGGGACGACCCCAACAACTCCCTCCTCTCCGTGCTCGAGCCCACTCGCGAGTACGACGGCGTCATCGTCGGAGTGC
GCGACCGCATGAAGATTGCCGGCCTCTCTGTGAGTGCTCAAATCTGCTTCGTTCAAGGAGGATCCGAAAAAAGGCTGCTGCAATGCGTAGATAGCCGTGTTTCTTGCATGTCGTGCTACG
TTGGGGTGGCGGGGCGTCTACCTTGGAGTGTGATGGGGACATTTTGGATACACCATTTCATCGATTTCATCCATAGTCGGTTTATCAGAAAGTGGGGGTTCCGTTTTCGTAGGGAACGCA
CAGGTGGCCGGCGTGATGGATATGGATTGTGCGGGATGGTGCTTGCTCCACACATTTGCCTTTGTCTTGGTTGTGTGATCTCATTCCCCAGTGAAATCGCCATTCCGTCTTCGTGCCCGA
GCAGGTGGCGCAGATGGTGGCACTCGCGGGGCGCCCTCGCAGTTCTTCTTTCATGACCGGCCTTGGGTACAGCGGCTCCTACACGGAAGATGACGCAGGTGCGTGTCGAGCCTGTGTCGA
TGTTCTGTTTGGGTATGGAATTTGTTTGTTCTTTGTAGCAGTTTCACCATTAAACTGATGTCACTTTGTACTTTGCAACGTGCACGTGAAAAAGGGCGGCAATTCTATGTTCGGCCCAAC
CCTTTCGATCACATCCTGATTCCTGTCGCATAAGTTTGTGGTGGTGGGTATCTCTTGTCTGGCGGAATTTCGTTCTGCATGAGTCAGCCCGCTTGCGACAAAACTCGTGACAAACTGGAC
AGTTGTCCCCGATGCAATGTCAGATCATTTCTGCGCCTTGCAACAGTCACCCCCCCGGTTTATAGTACATGAGTTCGGACGTTTTTCAGGCATGCGCGTACCGAAGCCGTGTCCGAACCC
GTACCGCCCCCGTGCCGTAGCTTCAATACTGCGCCACTGTTTCAGAACGCGGCTCGTTTCTAAAACCTGTGTTTGCTTGTATACCTCCGCACGGTTCCCGGCATCATCATCAGTCCTGTC
GAACACCCTCTACACCCTCCTGCTCACCGAGGACTGGGAGGAGGTGCCCGGGATGGACGGCAGGGAGTACCAGGCGGTCGGCAAGTCGGGCGTGTACGTCCTCAACACAGACCTAGCGCT
GGTCTGGGACCCCGAGTTCAAGGCCCAGTCCATCCTCTACGCGCAGGACAACGACTACTTCCGCGACGAGTTCGGGTCTGCTTGGACCGCTCTGATGGACGCTGATCGCTTCGACGGACC
CACGGGAAGCATGTGCGACCACTAGCGAGCATGTCGACGTTTCCTTCTCCTATCGGGGGTGCCTAGGACACCCTTGGCGCCACCTGTGCGATTACAACGGGTTTCGCCTCTCGACACCAA
GGTCGATACGGCGGCGACTCCGCCAGGGGCGTGTGCGATTACCTTTCTTGCATATCAGCCTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGCGGACCTCTCCACTCGCCCCGCCGACATCCTGTCGCACCTCGCACACTCCTGCTCTCCCCCTCGTTCCTCACACAACGAGGCAACACGCAACGGGGATATCGAGCTTGCTCTT
CTTGAACCCCGGGCAAGAAGCAACAGAGGCGTTCACCAAGTGCGCAAG
GTCTGCTTCGAAACGAACATGGGACGCACGTGTAATCTGGTGTGGCTCGCTGGCTTCGCCCTGGTTGCTCGG
ACTGCTTCCGGTGGATGCCCGTTCCTTTCAGGTCAAAAG
GACCTTGGCAGCCGCATTGGTGGCGAACGCCTCCTGTCCGGCGACCACGATGATGGTCACGAAGGAGGGGCCGATTACTCC
CGAGAGACGTACGAGGCCATCCAAGCCGACATCGTGTCCATGTTCGTCGACTCCAAGGACTTTTGGCCGGCCGACTTCGGCAACTACGGCCCTCTGTTCATTCGACTTGCTTGGCACTGT
GCAG
GTAGCTACCGCGCTTCCGACGGGCGAGGGGGCTGTGATGGCGGCAGGATCCGCTTCTTCCCGGAACACGGCTGGGCCGACAACACCAACCTGGACAAGGCCCTGACCCTCCTCCAG
CCCATCAAGCTCAAGTACGGCGACGCGATCTCATGGGCCGACCTCATCACCCTGACGGGAGACATGGCCATCTCGAGTATGGGGGGTCCCATCCTTGGTTTCTGCGCTGGAAGGCAGGAT
GATGACTCCGGTTACGACAGTCTCGAGCTCGGCCCAACTCCCGAACAG
GAGGCGACTGCTCCTTGCGCCGTGAACGGAACCTGCGAGCTCCCTCTCGGCACCAGCACCGTGGGGCTCATC
TACGTCAACCCAG
GCGGGCCAATGGGCGTCCCTGATCCGGAGGCCAGTGCGCCGCAGATCCGTGAAGTCTTCTCGCGTATGGGCATGAACGACACCGAGACCGTGGCGCTCATCGGCGGA
GGGCACGCGTTCG
GAAAGGTGCACGGGGCATGCCCCAGCGGTCCTGGCCCCGACCCCTTCGACGCCCCGGAGGCCCCCTGGCCCGGAACCTGCGGGGACCCCGATTCGGCCACGTTCGGG
CGCGCCGAGAACACCTTCACCTCCGGCTTTGAGGGGGCTTGGACGGAAGAGCCCACG
GTATGGGACAACAGTTACTTCGTCGACCTCCTAGAGTATGACTGGATTCAAGCCGAGAGCCCC
GCCGGCAACATCCAGTGGATTCCCGTCCTGAAGGAAGATGCCACCGAAACCGACGTTCCAGACATCATCATGCTGACTTCGGACGTCGCTCTGCTGATG
GACCCCGAGTACCTTGCTATC
GTGGAAGAGTTCGCCGCCGACCAGTATGCCCTGGACATCGCCTTCTCCAATGCCTG
GTACAAGCTCGTCACTCGCGACATGGGGCCGCACTCGCGCTGCGTCGGCACCGACGTCCCCCCC
CCGCAAGAGTTCCAGCTCCCGCTCGCCGACACGCCGAAGGACCTCCCGAGCTACTCTGGGGCCAAGGAAGCGATCGGCCGCATCCTCTCGGAGGAGTCGACGTACGCCCCCCTCTTCGTG
ACCCTGGCCTACCAGTGTGCGTCTACCTTCCGGTCTACCGACTACATGGGAGGCTGCAACGGCGCCAGGATCAGGTTCCCGCCCCAGAGCGAGTGGGCCAGCAACGCGGGGCTGAGTACG
GTGGCGCAGATGGTGGCACTCGCGGGGCGCCCTCGCAGTTCTTCTTTCATGACCGGCCTTGGGTACAGCGGCTCCTACACGGAAGATGACGCAGGACACCCTTGGCGCCACCTGTGCGAT
TACAACGGGTTTCGCCTCTCGACACCAAGGTCGATACGGCGGCGACTCCGCCAGGGGCGTGTGCGATTACCTTTCTTGCATATCAGCCTGTAA

Retrieve as FASTA