Entry information : MacuPrx100
Entry ID 13523
Creation 2015-12-15 (Qiang Li)
Last sequence changes 2015-12-30 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-31 (Achraf Jemmat)
Peroxidase information: MacuPrx100
Name MacuPrx100
Class Class III peroxidase    [Orthogroup: Prx059]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Musaceae Musa
Organism Musa acuminata (banana)    [TaxId: 4641 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MacuPrx100
start..stop
S start..stop
MguPrx12 383 3e-134 5..330 1..325
MguPrx36 378 4e-132 5..328 1..323
MguPrx44 375 9e-131 5..330 1..324
MguPrx84 373 4e-130 5..330 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20..238 219 N° 2 321..509 189 N° 3 597..762 166 N° 4 849..1267 419
join(20..238,321..509,597..762,849..1267)


exon

Literature and cross-references MacuPrx100
DNA ref. GenBank:   NC_025203.1 (8756658..8755202)
Cluster/Prediction ref. Genebank:   103970589
Protein sequence: MacuPrx100
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (304)
PWM (Da):   %s   36453.1 (33697.7)  
PI (pH):   %s   6.59 (6.42) Peptide Signal:   %s   cut: 27 range:27-330
Sequence 371
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSSMALSKSLLLLLLGFLCCSSTEAHVEFGFYNDTCPHAEAIVLHEMTRIIADDPTLAGSLLRMQFQDCFVRGCDASILLDSSNNNVAEKDAIPNKSLRGFDVIDRVKAKLEEACPGIVSCADIIAMAARDSVYLANGPYFPIQTGRRDGNKSEASDLMANLPPPTANITELKAFFLQKNLTVKDLVVLSGAHTIGFSHCSSFSQRLYNFSGKGDTDPSLDMEYAEKLKRKCKPHDHDDMRTLVKMDPKSPRRFDLCYYRLVSEGKGLFASDEALLHDPETRAYVERQAMASSAEEFFNDFGSSMVIMGKIGVLTHQKGEIRKKCAYVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns). Contain FQDC.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGGTCTTCCATGGCTCTGTCCAAATCCTTGCTGCTCTTGCTCCTTGGTTTCCTTTGTTGTAGCTCGACAGAAGCCCACGTCGAGTTTGGATTCTACAATGATACATGTCCCCATGCAG
AGGCTATAGTTCTTCACGAAATGACGAGGATTATAGCTGACGACCCAACACTTGCAGGCTCTTTGTTGCGGATGCAATTCCAAGATTGTTTTGTTAGA
GTATGCAACTGCGTCCTTCTTC
TTCTTACTTCGCCACAGACTTGAAAATATAGGGTAATAATGACAAGTTTATTGTACGAAGGGATGTGATGCTTCCATCTTGTTGGATTCTTCGAACAACAACGTGGCTGAGAAGGATGCC
ATCCCCAACAAAAGCCTTCGGGGTTTCGACGTGATCGATCGGGTCAAGGCTAAGCTGGAGGAAGCTTGTCCGGGGATCGTCTCCTGCGCTGACATCATAGCCATGGCAGCTCGCGATTCG
GTTTACTTG
GTAAGTCGTGTTATCTTATGCAACACACAGCCGAAGTATGAGTTTCGGAAGGTTGCTTCAGATATCTGAAGTCATTTGAATCTGCAGGCAAATGGACCATATTTTCCGATT
CAAACTGGCCGAAGAGATGGAAACAAATCAGAAGCTTCTGACCTCATGGCTAATCTGCCACCACCGACTGCCAACATCACCGAGCTCAAAGCTTTCTTCCTCCAGAAAAACCTAACCGTC
AAAGACCTTGTTGTTCTATCAG
GTACCCTTTCTTTATAGTTCTACTCGTACTTCTCTCGAAGAAAACGCTAAACATCCGAGTATGACTTTGGATCTTGTCATGATTAGGTGCACACACCA
TCGGTTTCTCCCATTGCTCATCCTTCTCGCAGCGACTGTATAACTTCAGCGGGAAGGGCGACACGGACCCATCACTGGACATGGAGTACGCAGAAAAGTTGAAGAGGAAATGCAAGCCCC
ATGATCATGATGACATGAGGACCCTGGTGAAGATGGATCCCAAGAGCCCCAGAAGATTTGACTTGTGCTACTACAGGCTCGTCTCCGAGGGGAAAGGCCTCTTCGCGTCCGATGAGGCTC
TCCTCCACGACCCCGAGACGAGAGCGTACGTCGAGCGCCAGGCCATGGCATCGTCGGCAGAGGAGTTCTTCAACGATTTCGGGAGCTCGATGGTTATCATGGGAAAGATCGGAGTGCTCA
CACACCAGAAAGGCGAGATCAGAAAGAAGTGCGCTTACGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGGTCTTCCATGGCTCTGTCCAAATCCTTGCTGCTCTTGCTCCTTGGTTTCCTTTGTTGTAGCTCGACAGAAGCCCACGTCGAGTTTGGATTCTACAATGATACATGTCCCCATGCAG
AGGCTATAGTTCTTCACGAAATGACGAGGATTATAGCTGACGACCCAACACTTGCAGGCTCTTTGTTGCGGATGCAATTCCAAGATTGTTTTGTTAGA
GGATGTGATGCTTCCATCTTGT
TGGATTCTTCGAACAACAACGTGGCTGAGAAGGATGCCATCCCCAACAAAAGCCTTCGGGGTTTCGACGTGATCGATCGGGTCAAGGCTAAGCTGGAGGAAGCTTGTCCGGGGATCGTCT
CCTGCGCTGACATCATAGCCATGGCAGCTCGCGATTCGGTTTACTTG
GCAAATGGACCATATTTTCCGATTCAAACTGGCCGAAGAGATGGAAACAAATCAGAAGCTTCTGACCTCATGG
CTAATCTGCCACCACCGACTGCCAACATCACCGAGCTCAAAGCTTTCTTCCTCCAGAAAAACCTAACCGTCAAAGACCTTGTTGTTCTATCAG
GTGCACACACCATCGGTTTCTCCCATT
GCTCATCCTTCTCGCAGCGACTGTATAACTTCAGCGGGAAGGGCGACACGGACCCATCACTGGACATGGAGTACGCAGAAAAGTTGAAGAGGAAATGCAAGCCCCATGATCATGATGACA
TGAGGACCCTGGTGAAGATGGATCCCAAGAGCCCCAGAAGATTTGACTTGTGCTACTACAGGCTCGTCTCCGAGGGGAAAGGCCTCTTCGCGTCCGATGAGGCTCTCCTCCACGACCCCG
AGACGAGAGCGTACGTCGAGCGCCAGGCCATGGCATCGTCGGCAGAGGAGTTCTTCAACGATTTCGGGAGCTCGATGGTTATCATGGGAAAGATCGGAGTGCTCACACACCAGAAAGGCG
AGATCAGAAAGAAGTGCGCTTACGTCAACTAA

Retrieve as FASTA