Entry information : HaPrx34 (HanXRQChr08g0226521)
Entry ID 13555
Creation 2016-04-27 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx34 (HanXRQChr08g0226521)
Name (synonym) HaPrx34 (HanXRQChr08g0226521)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx34
start..stop
S start..stop
HaPrx03 530 0 1..333 27..388
HaPrx14 503 0 21..333 17..324
LePrx80 430 2e-152 1..334 1..325
CroPrx58 416 2e-146 25..333 52..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 81473179..81473418 240 N° 2 81473926..81474117 192 N° 3 81474231..81474396 166 N° 4 81474714..81475120 407
join(81473179..81473418,81473926..81474117,81474231..81474396,81474714..81475120 )


exon

Literature and cross-references HaPrx34 (HanXRQChr08g0226521)
DNA ref. HanXRQ genome:   HanXRQChr08 (81473179..81475120)
Cluster/Prediction ref. HanXRQ:   HanXRQChr08g0226521
Protein sequence: HaPrx34 (HanXRQChr08g0226521)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (310)
PWM (Da):   %s   35898.22 (33451.8) Transmb domain:   %s   i5-24o
PI (pH):   %s   8.63 (8.39) Peptide Signal:   %s   cut: 25 range:25-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRKNILVLLVASILLVGCMGGAHGKGHGKGGGLKMKYYQNLCRSVSVENTVRDIVWSKVSADPAMAAKLLRLHYHDCFVRGCDGSILLDPTQNTTTEKTAGPNRSISGYEVIDEIKTKLEANCPGTVSCADIVALAARDAVSFQFRREMWPVFTGRKDGRVSLASEVGGNLPSANANFTTLLNQFGTKGLNLNDLVTLSGAHTIGISHCTLVARRLYNFTGVGDADPSLDPTYAQTLRNLCPNPINPSTALEMDPNSSLSFDSDYYRALNQHKGLFVSDAALLTNRQSASVAKILENPKLFFAQFAMSMVKMGAVEVLTGGQGEVRTNCRVVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGAAAAACATCCTTGTACTTTTGGTTGCTTCCATTTTGTTGGTTGGGTGCATGGGTGGTGCTCATGGGAAGGGCCATGGGAAGGGTGGTGGCTTGAAGATGAAATATTATCAGAAT
CTATGTCGTTCGGTTTCGGTTGAAAATACAGTTAGGGATATTGTATGGAGCAAGGTTTCTGCAGATCCTGCCATGGCTGCCAAGCTTCTAAGGCTTCATTACCATGACTGTTTTGTTAGG
GTAACTAACCAACCATCTATTTATTCATATATTTTGGGAAAACTGGTGTTTTTAGTTAAACTATTTTGGTGTAATCTTTTTCATAATTTATAGTGTAGTCACACTTGGGAGGCGCAACTT
CGTGGAGCTCGTATATCTCAAGATGAATTTTTTTTTTTTGAGTAAAGTCACACTTGTCAACAACGGCTTTAGGTGAAGTCGCATTTGTCAATAACGACTTTAATTAGTTGAGGTCACATT
CGATAACTGTGACTTGTTTTGAATGAAGCCGTTTTTGCCAGGTGCCAATTCACCTAAAGTCGTTAGGTTCATTTATTTCCAAAGAACATTTATACTACCCTTCCCAAATAGTCATTCGAA
AACACCATTTTTCTAAAAATATGTAATCCATGGTCTTTATGGCTACCGTATATTGTTTAGTGGATTCAAGCTTGCTAAGTTTAGATTTAGAATAGTTTGAGTTGTTTACTTGTTGCGTGT
TACAAATGATAACCTTTGAAATTTCAGGGATGTGATGGATCAATTCTACTGGATCCTACTCAAAACACAACAACAGAAAAGACTGCTGGACCAAACAGATCTATTTCTGGGTACGAAGTA
ATTGATGAAATAAAGACAAAGTTGGAAGCCAATTGTCCCGGAACTGTTTCTTGTGCGGACATTGTCGCCCTAGCAGCTAGAGATGCGGTTTCATTCCAA
GTAACTTGTGTTTCTTTTTTT
TTTTTTTCATTTTTTTTGGTGAAGGGGGTGGGCCTTTCAAAACGTTGTTGTGTTTATAAAAATCTTGGTTTCTTCGTCAATGAAAATTGCAGTTTCGAAGGGAAATGTGGCCGGTTTTTA
CGGGAAGGAAAGATGGAAGAGTTTCATTGGCATCAGAAGTTGGTGGGAATTTACCATCTGCAAACGCTAATTTCACTACCCTCTTAAACCAATTTGGAACCAAAGGCCTTAACCTTAACG
ACCTCGTGACACTTTCAG
GTATACAATCTTTCTATATATGATTCTTTTGGATTAACAAGTGGTTTAGGATTCAGCTACGTATTTCAAGGCATTTTTCGAAGTTTTAGGAGTACAAGAACC
TCCAAAAAAAGTCTAAAAATACTTATAGCTGAATCCTAAACCAAAATCAACATTCTTCGGTATGTGCATGCAACATACACACGTATGTATATATATGTACATGTATATATATGTACATGT
GTATGCATGCACGCATGCATAAATACATACCTCTATATACTTCTTTTCTACAACATCTTTTTGTTATTAACTAAAGTTATGTATAATTTAACTAGGGGCACACACAATTGGGATCTCACA
TTGCACCCTCGTCGCCCGAAGACTCTACAACTTTACAGGAGTCGGAGATGCTGACCCGTCTCTTGACCCTACTTATGCACAAACATTGAGGAACCTATGCCCAAACCCTATCAATCCAAG
CACCGCTCTTGAAATGGATCCTAACAGCTCTCTCTCGTTTGATTCAGACTACTACCGGGCGTTAAACCAACATAAAGGTCTATTCGTATCTGATGCGGCATTACTCACAAACCGTCAATC
AGCTTCGGTGGCAAAAATTTTAGAAAACCCAAAACTTTTCTTTGCTCAATTTGCCATGTCCATGGTTAAAATGGGAGCTGTTGAAGTTCTCACCGGTGGTCAAGGAGAAGTCAGGACAAA
TTGTCGAGTCGTTAATAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGAAAAACATCCTTGTACTTTTGGTTGCTTCCATTTTGTTGGTTGGGTGCATGGGTGGTGCTCATGGGAAGGGCCATGGGAAGGGTGGTGGCTTGAAGATGAAATATTATCAGAAT
CTATGTCGTTCGGTTTCGGTTGAAAATACAGTTAGGGATATTGTATGGAGCAAGGTTTCTGCAGATCCTGCCATGGCTGCCAAGCTTCTAAGGCTTCATTACCATGACTGTTTTGTTAGG
GGATGTGATGGATCAATTCTACTGGATCCTACTCAAAACACAACAACAGAAAAGACTGCTGGACCAAACAGATCTATTTCTGGGTACGAAGTAATTGATGAAATAAAGACAAAGTTGGAA
GCCAATTGTCCCGGAACTGTTTCTTGTGCGGACATTGTCGCCCTAGCAGCTAGAGATGCGGTTTCATTCCAA
TTTCGAAGGGAAATGTGGCCGGTTTTTACGGGAAGGAAAGATGGAAGA
GTTTCATTGGCATCAGAAGTTGGTGGGAATTTACCATCTGCAAACGCTAATTTCACTACCCTCTTAAACCAATTTGGAACCAAAGGCCTTAACCTTAACGACCTCGTGACACTTTCAG
GG
GCACACACAATTGGGATCTCACATTGCACCCTCGTCGCCCGAAGACTCTACAACTTTACAGGAGTCGGAGATGCTGACCCGTCTCTTGACCCTACTTATGCACAAACATTGAGGAACCTA
TGCCCAAACCCTATCAATCCAAGCACCGCTCTTGAAATGGATCCTAACAGCTCTCTCTCGTTTGATTCAGACTACTACCGGGCGTTAAACCAACATAAAGGTCTATTCGTATCTGATGCG
GCATTACTCACAAACCGTCAATCAGCTTCGGTGGCAAAAATTTTAGAAAACCCAAAACTTTTCTTTGCTCAATTTGCCATGTCCATGGTTAAAATGGGAGCTGTTGAAGTTCTCACCGGT
GGTCAAGGAGAAGTCAGGACAAATTGTCGAGTCGTTAATAGTTAA

Retrieve as FASTA