Entry information : HaPrx101 (HanXRQChr13g0393831)
Entry ID 13562
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx101 (HanXRQChr13g0393831)
Name (synonym) HaPrx101 (HanXRQChr13g0393831)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx101
start..stop
S start..stop
HaPrx26 637 0 1..327 1..326
LsaPrx08 592 0 6..327 5..325
HaPrx27 590 0 1..326 1..324
EglPrx137 544 0 1..326 5..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 50268738..50268950 213 N° 2 50268024..50268215 192 N° 3 50267743..50267908 166 N° 4 50266141..50266553 413
complement(join(50266141..50266553,50267743..50267908,50268024..50268215,5026873 8..50268950))


exon

Literature and cross-references HaPrx101 (HanXRQChr13g0393831)
DNA ref. HanXRQ genome:   HanXRQChr13 (50268950..50266141)
Protein sequence: HaPrx101 (HanXRQChr13g0393831)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (304)
PWM (Da):   %s   35704.36 (33346.0) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.94 (9.94) Peptide Signal:   %s   cut: 24 range:24-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAQSTSITVFVVLIISTLALVNGSYLYPQFYDRSCPKAKDIVRSVVAKAVAKEARMAASLLRLHFHDCFVKGCDASILLDNSGSVISEKGSVPNRNSARGFEVIDQIKAALEKACPQTVSCADIMALAARDSTVLAGGPSWEVPLGRRDSLGASLSGSNQNIPAPNNTFQTILTKFKLKGLDIVDFVTLSGSHTIGNARCTSIRQRLYNNTGNGRPDFSLDQSYAARLRQNCPRSGGDQNLFFLDPVSPTKFDNNYYKNLIAKKGLLSSDEILFTQNQQTMQYVKQYAANQELFFQQFAKSMVKMGNISPLTGKSGQIRKICRKVNS

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCAATCGACTTCAATCACCGTGTTCGTGGTTCTAATCATCTCTACCCTGGCTCTAGTCAATGGGTCTTACCTCTACCCTCAGTTTTATGACAGGTCATGTCCAAAGGCTAAAGAC
ATTGTTCGGTCTGTTGTCGCAAAAGCTGTTGCGAAAGAAGCTCGTATGGCGGCTTCTTTACTCAGACTCCATTTCCACGATTGTTTTGTCAAG
GTTTGTTCTTTACTGCTAGAAAATACA
ACCGTTTATGGTGAAATTAAATTGCAACATAGAAATAAGTCACAACTTCTCTTCGTTTACATCCCTACACTCAAAAGTAGCGGTGTAAAAAGGAGAGGTGTAAGCTATTTTTCGAGCTCG
ATATTTGAAGCTTGAGCTTAGCTTATAAACAGTTTTTACTTTTTTCATTTCAGAGTTAGCCTTGTTTAATTATTTATGGATTACTTAATTGTTTTATGTATATACATATCTAATAATCAT
TTATATGCATTTATAACTATAACTATATATAACATTAATTTATTTATTTTGATCATAATATATGTGTTTAATATGTAATATGTATTTATCATATTAAATTAGTACTGTTATATCTATATA
AATAATGTTCTTTTGAGCCAAGTCAAGCTTTGTACATGAAGCTTTGTGCAATGTTTATATGAAAATACTGCAAATGTTATTACAATGATCACAAACTAATAACTAGCTTTGCAACCAAAT
GATGGATGATTTTAGGGGTGTGATGCTTCAATTCTTCTCGACAACAGCGGAAGCGTAATTAGCGAGAAGGGGTCCGTCCCTAACCGCAACTCGGCCCGTGGGTTTGAAGTCATTGATCAA
ATCAAAGCTGCATTGGAAAAGGCGTGCCCACAAACCGTCTCCTGTGCTGATATCATGGCTTTGGCAGCTAGAGACTCCACCGTTTTG
GTATAGTACCGTAGATCATAGAACGATATAATA
CCGATTTGTATTGTACAACTCTTTAATCCATACAATTTGGTTTTCCTTTTTCTTTGTATAAACATGTTTTACACTTGTGTAGGCTGGTGGACCAAGTTGGGAAGTCCCATTGGGCAGAAG
GGACTCACTAGGTGCAAGTTTGAGTGGTTCAAACCAAAACATTCCAGCTCCAAACAACACTTTTCAGACCATTCTCACAAAATTCAAGCTCAAGGGTCTTGACATTGTTGATTTTGTAAC
ACTTTCAG
GTAAGACCTAGTTGGGAACTCAGTTATAAATCAAGAAAACTCTTGAAATAAATGTTTAAATAGGTCGTGTTTGCGGGTTCTCGGGTCGAACTCGACACGAACACGTAAATTT
GAAACAAACCATAGCACTACAAAACCCCGAGAAATATGATATACATGACCGATTACGACACGACACGAGTTTTCACAAGTTAAACCAATATGGCCCTTTTAACCTCATTTTATGTAATAT
TATAAAATAATTAAATTTGCAAATTTATAACAAAAGAATACATATATACATATAAAACCGTTATGTTCAGTGGCGGACCTATAAATTATTTGTTGGGGTGCGGATGACGTGTTCAACCAT
ATCTTCAAGGAGTGCAGTCGGGTTTTTTTACCTAAAATATACACTAATTTTTTTCAAGGGGTGCGGCCGCCCACCCTGACCAAAGGGTAGGTCCGCCCCTGGTTATGTTTAAACCGTTAA
AGTTGATGTTCTTTTCTATCTTTTAACTTTGACATATAATATACAAGTGCAAGTTATAGAATAATAATACTTCTTTTAACAAATTTTAAAATAAAATTTATAATATTAATGGATCAACTT
CACTACCCGTTTAGAGCATTCATATCCTATCCATCAAATTATATATACATTCCACTAAAAAACAACTCCTATATCAATATATTTTCACTAAAAACAAATACTTTTTCTCTCTCCTTTCAA
TTAAATAATATTATTATTACATTTTTCTCTCTCATTCACTCACAACCACTTTCAATATATATTAAAAAAATTATAGTGGATGAACAGTGTCTTCTCAAATATACAGATGAACAGTAACAT
TTTCTCTCTCCTCCACTCACAACCACTTTTTATACCCTTTATAATATAAAAACTCCCCTCACATATTTTGATGGATAGAATGTGAATGCTCTTAGCTAAACATATTTGTGTGTTGGTCAT
GAAAGTGAACCAAATCCTTTTAGACTAAACCCAAATCCACATTATTTATGTTAGGTTCATGTCGCGGTTCACTCAACTTTTTTATAACCTCTTGAATTGTTTAATCCATATGATTTTAGT
AGTTTTTGTAACAACTTCGACTTAAAGACTATATTTTTTAAATTAAAAATGAAAATAGATAAAAAGTATTGATGAACCCGAACACGTCTCATATTTGACTTGTTCTAAACTTTCCAGGAA
GTCACACAATAGGAAATGCTAGGTGCACCAGTATCAGGCAAAGGCTATACAACAACACGGGCAACGGGCGGCCAGACTTTTCGCTAGACCAATCATACGCAGCAAGGCTTCGCCAGAACT
GCCCGAGATCTGGGGGCGATCAAAATCTGTTTTTCTTGGATCCTGTGTCACCGACAAAATTCGACAACAATTATTACAAGAACCTAATAGCTAAAAAGGGACTTCTAAGCTCTGATGAAA
TACTTTTTACTCAAAACCAACAAACAATGCAGTATGTGAAGCAGTATGCCGCAAATCAAGAGCTTTTCTTCCAGCAGTTTGCAAAGTCAATGGTTAAAATGGGAAATATTTCTCCATTGA
CCGGTAAAAGTGGTCAAATCAGAAAGATTTGTAGGAAAGTCAACAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCAATCGACTTCAATCACCGTGTTCGTGGTTCTAATCATCTCTACCCTGGCTCTAGTCAATGGGTCTTACCTCTACCCTCAGTTTTATGACAGGTCATGTCCAAAGGCTAAAGAC
ATTGTTCGGTCTGTTGTCGCAAAAGCTGTTGCGAAAGAAGCTCGTATGGCGGCTTCTTTACTCAGACTCCATTTCCACGATTGTTTTGTCAAG
GGGTGTGATGCTTCAATTCTTCTCGAC
AACAGCGGAAGCGTAATTAGCGAGAAGGGGTCCGTCCCTAACCGCAACTCGGCCCGTGGGTTTGAAGTCATTGATCAAATCAAAGCTGCATTGGAAAAGGCGTGCCCACAAACCGTCTCC
TGTGCTGATATCATGGCTTTGGCAGCTAGAGACTCCACCGTTTTG
GCTGGTGGACCAAGTTGGGAAGTCCCATTGGGCAGAAGGGACTCACTAGGTGCAAGTTTGAGTGGTTCAAACCAA
AACATTCCAGCTCCAAACAACACTTTTCAGACCATTCTCACAAAATTCAAGCTCAAGGGTCTTGACATTGTTGATTTTGTAACACTTTCAG
GAAGTCACACAATAGGAAATGCTAGGTGC
ACCAGTATCAGGCAAAGGCTATACAACAACACGGGCAACGGGCGGCCAGACTTTTCGCTAGACCAATCATACGCAGCAAGGCTTCGCCAGAACTGCCCGAGATCTGGGGGCGATCAAAAT
CTGTTTTTCTTGGATCCTGTGTCACCGACAAAATTCGACAACAATTATTACAAGAACCTAATAGCTAAAAAGGGACTTCTAAGCTCTGATGAAATACTTTTTACTCAAAACCAACAAACA
ATGCAGTATGTGAAGCAGTATGCCGCAAATCAAGAGCTTTTCTTCCAGCAGTTTGCAAAGTCAATGGTTAAAATGGGAAATATTTCTCCATTGACCGGTAAAAGTGGTCAAATCAGAAAG
ATTTGTAGGAAAGTCAACAGTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTTCAATCCG GTTTTTCACT TCCATCACAA ACACAAATCT TTCATTAACC ACAATGGCTC AATCGACTTC AATCACCGTG TTCGTGGTTC TAATCATCTC TACCCTGGCT CTAGTCAATG  GGTCTTACCT CTACCCTCAG TTTTATGACA GGTCATGTCC AAAGGCTAAA GACATTGTTC GGTCTGTTGT CGCAAAAGCT GTTGCGAAAG AAGCTCGTAT GGCGGCTTCT TTACTCAGAC  TCCATTTCCA CGATTGTTTT GTCAAGGGGT GTGATGCTTC AATTCTTCTC GACAACAGCG GAAGCGTAAT TAGCGAGAAG GGGTCCGTCC CTAACCGCAA CTCGGCCCGT GGGTTTGAAG  TCATTGATCA AATCAAAGCT GCATTGGAAA AGGCGTGCCC ACAAACCGTC TCCTGTGCTG ATATCATGGC TTTGGCAGCT AGAGACTCCA CCGTTTTGGC TGGTGGACCA AGTTGGGAAG  TCCCATTGGG CAGAAGGGAC TCACTAGGTG CAAGTTTGAG TGGTTCAAAC CAAAACATTC CAGCTCCAAA CAACACTTTT CAGACCATTC TCACAAAATT CAAGCTCAAG GGTCTTGACA  TTGTTGATTT TGTAACACTT TCAGGAAGTC ACACAATAGG AAATGCTAGG TGCACCAGTA TCAGGCAAAG GCTATACAAC AACACGGGCA ACGGGCGGCC AGACTTTTCG CTAGACCAAT  CATACGCAGC AAGGCTTCGC CAGAACTGCC CGAGATCTGG GGGCGATCAA AATCTGTTTT TCTTGGATCC TGTGTCACCG ACAAAATTCG ACAACAATTA TTACAAGAAC CTAATAGCTA  AAAAGGGACT TCTAAGCTCT GATGAAATAC TTTTTACTCA AAACCAACAA ACAATGCAGT ATGTGAAGCA GTATGCCGCA AATCAAGAGC TTTTCTTCCA GCAGTTTGCA AAGTCAATGG  TTAAAATGGG AAATATTTCT CCATTGACCG GTAAAAGTGG TCAAATCAGA AAGATTTGTA GGAAAGTCAA CAGTTAAAAT GTGCTTATCA AACTATCATG ATCAAATTTA GTAACTATTG  TGTTTTGATG TTAAAAAGTG CTTTTGATTT TTTACTATAT CTTGTTATGA TCAATAAGAT AAGTATTGTA AGTTTCATTT TTTTTTTAAT TTTCTTTATA TTAATGAAAT CGTCTGAAAA 
TCAG 

Retrieve as FASTA