Entry information : HaPrx102(HanXRQChr13g0397201)
Entry ID 13563
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2017-11-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2022-02-28 (Catherine )
Peroxidase information: HaPrx102(HanXRQChr13g0397201)
Name HaPrx102(HanXRQChr13g0397201)
Class Class III peroxidase    [Orthogroup: Prx032]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx102
start..stop
S start..stop
HaPrx43 524 0 1..325 1..330
HaPrx24 495 2e-178 3..324 1..324
HaPrx42 486 1e-174 3..324 1..325
PpePrx68 427 1e-151 3..324 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 74593412..74593633 222 N° 2 74593124..74593303 180 N° 3 74592881..74593043 163 N° 4 74586289..74586701 413
complement(join(74586289..74586701,74592881..74593043,74593124..74593303,7459341 2..74593633))


exon

Literature and cross-references HaPrx102(HanXRQChr13g0397201)
DNA ref. GenBank:   MNCJ01008719.1 (178399..171055) HanXRQ genome:   HanXRQChr13_494 (74593633..74586289)
Cluster/Prediction ref. HanXRQ:   HanXRQChr13g0397201
Protein sequence: HaPrx102(HanXRQChr13g0397201)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (300)
PWM (Da):   %s   34453.16 (31901.8) Transmb domain:   %s   i9-31o (i9-31o)
PI (pH):   %s   5.07 (4.91) Peptide Signal:   %s   cut: 26 range:26-325
Sequence 366
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMTNTKAAALAVGFIFLNLTCVLGGLQYGFYDGKCETSDVEAIVRNTVFSEFLVDQTIAPALIRMHFHDCFVNGCDASILLDGHNAEKTAPPNLSVRGFDVIDAAKAAVEGVCPGVVSCADIIAIATRDVVALSGGGRYTVQTGRRDGLVSLAENTIVLPAPNASVSSAIHTFASKGLTATDMVYLSGGHTIGVAHCSLFKDRLYNFNNTGEPDPTMDLGLLTWLRLVCPQNATVDSTANLDQNSSTSSTVDNSFYTQIMLHRGVLQFDQELALDPLTQSTVAAIAHSDDFNTKFGQAMVKMGAIQVLTGEQGQIRKSCRAINL

Retrieve as FASTA  
Remarks Complete sequence from genomic. N in the genome asembly but WGS without
Incorrect prediction in Phytozome (3 exons instead of 4 real)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGACAAACACTAAAGCAGCTGCACTAGCAGTTGGGTTCATCTTCTTGAACCTTACTTGTGTTCTTGGTGGTCTTCAGTATGGGTTCTATGATGGCAAGTGTGAAACTTCAGAT
GTTGAAGCCATCGTTAGAAACACGGTCTTCTCCGAGTTCCTCGTGGATCAAACAATCGCTCCTGCGCTGATTCGCATGCACTTCCATGATTGCTTTGTTAAT
GTAAGTATTTTCCAATAT
CATGCATGCATGCATGCATGCAAAAAAGTTTCATAAAACCCTAACTAATCATTTTAAATTTGTATGGATTAAATAATTTAAATTTAAAAGGGTTGTGATGCATCGATTCTACTTGACGGA
CACAACGCCGAAAAAACTGCACCGCCAAATTTAAGCGTTAGAGGTTTTGATGTGATTGATGCTGCAAAAGCCGCGGTTGAGGGGGTGTGCCCAGGGGTGGTTTCTTGTGCTGATATAATT
GCTATAGCTACAAGAGACGTTGTTGCCTTG
GTAAGTATAACAATGCATCTTATTATAGTTAATTTTGTCAGTTTAATTATATATTAACTATGAAAATTATGTTAATGTAGAGTGGTGGAG
GTAGATATACTGTCCAAACAGGAAGAAGGGATGGACTTGTGTCTCTTGCCGAAAATACTATAGTACTCCCTGCTCCTAATGCGTCCGTGTCAAGCGCGATTCATACTTTTGCGAGCAAAG
GACTCACCGCCACCGACATGGTCTATCTTTCTG
GTAATTGTTTTACTGAGTTCTTATCTCATGTATTATAAATTTCCATCAATAGTTACCACTAGAGGTGGCAAGATGGGCATGTTGTAT
GAGTTGAGTAGTTAGCCAAAATGGGGTCAGATCGAAACATATTATACACTGGATGTGTCAAAATGGGCTGGGTCCGATTCGTTGACCTAAAATTTTATTTTTTTATATGGTATACTATTT
TTTATACTTCTAGGTAGTCTAGAAAAATTATAAGCGTTTGAAAACCGGTTAATCTCTTAACATCATGTACATAGTTAGATAGTTAGAATTATTATTAAGTAGCGGTTACAAAGTACGAGG
ACCAGAAGTGACAAAATGGAAGTTGAAAACTACCTCAATAACCGAATGGATGTGTCTCTACACACACACACCATTTCGAATCGGTACAAGGAAAAGAAGAAGAAGACGCGACGGTTGGAA
CGAGTGGACAAGATTCAACACACCTCTTCAAGATTCAATCTCAACCACATATCCAAGAGACGTGTCCTTTCACGAAGAGACGCAACTATTCACTCGTACCCGTAGGAAACTATAAATAGG
GATAGTTAGATTCATTTGTACTTGTTCATTACATTCGAAATCAATTGTATATACTCTCAATCGATATTGTATACATTCGGTTATTATCAAGTTATTCAAGTTGTTGTTATTCAAGTTATT
CACGCTCATTTAGAGATCAAGATCCAAGTTCGGGCCAACAAATTGGTATCAGAGCATCAGGCTCTAGGCGTGGGAATCGCAAGGCATCGCAGGGAATTCGCGATCAGGTTTCAATTTCGT
TTAAATTCGCAAAAGTTTCATTTCAGAATTTTATTTTCGGTTCTAGGAAAGTCGGTCGAACCGAACGGTTAGGAATCTAGGGTTCGTTTGTTTTTGATTCCGGGGTTATAGTGCGAATTA
GTTTGATTTTGGTTATTTGGTTATTACACGATTCGGGTAATCGGGGTTGTTGAGATATATTGAAACCAAAAGAAAGTTTATTAGAAGTGAAGATTATTCGGCAGGAAGATATGGCAGGAT
CATCCGGGCAAAGTCCGATAAATGGAAATTCTCTTTCCCAGTTTCAGTGTCCGATTCTGAAACCAACAAACTATACGGTTTGGGCTATTCGTATCAAGACGATTCTTGAAGCGAATGGTT
TGTGGGAAACGATTGAACCGGCAGAAAATGCAACGGTAGACACTAAGAAAGATAAGTCTGCCATTGCATATCTGTTTCAAGCAATACCAGAAGACGTTGTATTGCAAGTCGCAAGTTGTA
AAACTGCAAAGGAGATTTGGGAAAATCTAAAGATTAGACACGTTGGCGTTGATCGGGTACAAAAGCGCGTATGCACACGCTAATGTCAGAATTTGAATTGTTGCAAATGAGGGATGACGA
CACTATTGATTCGTTTACCGCAAAGATTAATAGTATCGTTACCCGAGCAACTGAAGTAGGAACGACAATGAGTCAACCGACTCTAGTACGCAAACTCTTAAATGGCGTACCAGATAAGTT
TACTCAAATCGTTGCCTCTATGGAACAATACTCCGATCTAGAAACCATGACGCTACAGGAAGCGGTCGGAAGACTAAAGACGTATGAAGAACGTCTCAAGTTAAAGAAAGGAAGTCAAGG
AGAAAGCCAAGATAGGCTTATGTTTACACATCAGGATAACACCAGAGGAAGGCAATCTGGAAACCGCGGTCGTGGTAGATTTAACCAGACGCGTGGCAATTGGCGTAACAACGGAAATAG
GCAAAGTCCCAGAAACGAAGGATCTACATCAAGACCTAGAAATGAGAATTCTAGAAATTGGAGGAAGTTTGCAAGAACCGACCTAAGTAAAATCCAATGTTTTAAGTGTCAAAAGTTTGG
ACACTACAAGAAGGACTGTTCAGAGAAAGACGATGTACAAGAACATTCAAACCTCGTCGAGGAAGACGAAGCACCCGTATTATTAATGACAATACAAGAAGAAAATGTTCAAGAAAGGGC
TCTGCTAAACGAGGAACATATAAAACCGACAAGTTATGCCTCAGACAATGAAAATCTATGGTACTTAGACAACGGGGCCAGCAACCACATGACAGGAGTGCGAAGTCACTTCAAGGAATT
AGATGAAACTGTGACAGGGCAAGTACGATTCGGTGATGGGTCACACGTAGAAATTAAAGGCAAAGGTTCAATAGTACTGGAATGTCTGAACCAAGAACAAAAGATTGTTTCACAAGTATA
CTACATTCCAAGTCTGAAAACCAATATATTGAGCCTCGGACAACTTACAGAAATCGGTTGCAAAGTGGTTATGGACGGAGATTTACTTACTATCCGAGATCGAAATAGAAAGCTACTAAT
GCGAGTCAAGAGAATGAAGAACAGGCTGTACAAAGTCAAACTGAAAACGGGAAAACCAATCTGCTTACTATCAAAGACCGAAGACACAGCATGGTTATGGCACGCAAGGTTAGGCCACTT
ACACTTCGACGCTATTAAGGAAATGACTCGTAAGAACTTGGTACATGGAGTTCCCCAAATAAGTCATGCTAGTCAAGTCTGTGACGCATGCTTATTAGGAAAGCATAGTAGGGCACCATT
TCCAAATCAGGCAAAGTTCAGATCTTTAAAACCTCTGGACTTAGTCTATGGAGATTTGTGTGGTCCTATAACTCCACCAACACATGCTGGGAAGAAGTATATATTCTTACTTGTAGACGA
CTGTACTCGCTACATGTGGGCATATTTACTAATTTCCAAGGATCAAGCATTCGAAACATTTAAGGAGTTCAAAGAAAAGGTGGAAAAGGAAGCGCAGACCAAGTTAAAAATGCTAAGAAC
GGATAGAGGAGGTGAATTCACATCGGCTGAATTCAACAAGTATTGCAAAACCAACGGCATAGCAAGACAGCTTACAGCACCATATTCCCCACAGCAAAATGGAGTAGTGGAAAGAAGAAA
CAGGACGATGTTGTCAACTACTCGCAGTATGCTAAAGGCAATGAACATGCCACAGAACTTTTGGGGTGAAGCAATACGACACGCGATATACGTACTAAACAGGGTTCCGACAAAAGCCCT
GGTGAACAAGACACCATATGAAGCACTAAAAGGAAGGAAGCCAAATTTAGAACACTTGAAGATTTTTGGCTGCACTGCTTACGCTAAGGTACTACCACTTCAACAAAAGAAGTTAGATGA
TAGAAGTGCACCTATGGTTTACCTTGGAATAGAAGAAGGATCAAAAGCATACAGATTATATGATCCAGCAAAGAACAAGATATGTGTCAGTAGAGATGTAAAGTTCATGGAAGGTCAACC
ATGGAACTGGAATAGTTATATGGAGACGGTAGATTCAGGGAATCCCGAATGGACAAACTTTGTCATTCAAGAAGATGACGTACCACCAGAATTAGAAGAAAATGAGCCAAGTAGTCCAGG
TAGTAGCGGGCCACATCATGACGATTCAGGAGTAGATCAGACAGAGGAACCAGACTCCTATGTAACCCCGCCAGCACATTCGTACAATCAGAACTCAGCAGGAAATACAAGCAATCTATC
AAGTGGAGGTCCATCCACTTCTGAAAGTATAACGGAGAGTATCAGTGACACTCCAGTAAGATTAAGAAGTCTCGAAGACCTGTATGAAGAGACAGAAGAAATTCAACTAGATCCACATGA
ATTATTACTCGCTAAAGAAGAACCAAGGAATTACAAGGAAGCATCTAGTGACAGAAAGTGGATTGAAGCAATGAAGGCTGAATTAGACTCAATAAACAAGAATAACACTTGGAATTTGAC
GGAGTTGCCAAGAGATCACAAAGCAATAGGTTTAAAGTGGGTATTCAAGACTAAGAAAGATGCAAACGGGAATATTGTCAGACATAAAGCAAGCTAGTTGCAAAAGGATATGTTCAGCAA
CACGGAATAGACTTTGACGAAGTCTTTGCACCAGTAGCACGTATGGAAACAGTACGACTAATGTTGGCTTTAGCAGCATATCAAGGTTGGGAGGTACATCATCTAGATGTGAAATCTGCA
TTCTTACACGGAGATCTCAAGGAGGAAGTCTATGTATCACAACCAGAAGGATTTATAAAGCCAGGAAATGAAGGAAAGATTTACAGACTATCAAAAGCACTGTATGGATTGAGACAAGCA
CCAAGAGCTTGGAATACGAAGTTAGATCAAACCCTAAAGTCACTTAACTTCAAGAAATGTACTTTAGAGAATGCAATCTATACAAGAACAAGGGAAGCCTCTACACTAATAGTTGGAGTC
TATGTTGATGACTTGATAGTCACTGGAACATCAAAGAAGGAGATAGACATCTTCAAATCTCAGATGAAGAACAAATTTGATATGAGCGATCTAGGATTGCTAGCATACTATCTGGGAATA
GAAGTGATTCAAGCAGGGGGTGAGATAGGCATCAAGCAGACAGGATATATCAACAAGATACTCAAAGACGCTGATATGTTATCCTGCAATGACACAAAGACACCCATGACTCCAGGAACT
CAATTAACAAAGACTGAAGAAGGAGATCTAGTAGATGCAACACATTACAGAAGCCTGATAGGATCTCTCAGGTACTTATTGCATACAAGACCAGATCTATGTTACCCAGTCAGTTTACTC
AGTAGATTCATGCAAGAACCAAAAGAACAACACCTGAAAGCAGTAAAGCAAATACTACGTTACATCAAAGGAACTAAAGAGCATGGAATCATCTACAGAAGACAAGGAGGATGTAAGATC
ACAGGTTATAGTGACAGTAGTTTTGGAGTTGATACAGACAAAGGAAAAGGAACAACTGGTCTGGTATTCTACTTTGGAGAATCACCTATAACCTGGTGTACACAGAAGCAACAGACAGTG
GCACTATCATCATGCGAATCAGAATTCATGGCAGCCACTGCAGCAGCATGTCAAGCACTATGGCTTAAAAGATTGTTAAGTGAAATCACAGGCTGGAAGGAAGAGAAGATAACACTCAGA
GTAGATAATGTTTCAGCAATAGCACTCATGAGAAACCCAGTCTTTCATGGAAGAAGCAAGCACATTGACACACGCTATCACTTCATAAGAGAATGCGTGGAAAACGAAGATATCACTGTG
GAACACATAAGCGGAGAACTACAACGGGCAGATATACTAACAAAGGCACTAGCAAGGATCAAGTTTGCTACAATGAGGGAACTGCTCGGAATTCAAGATTTAAAGCAACTCATGGATGTT
AGAGATTAAGGGGGTGAATGAAAACCGGTTAATCTCTTAACATCATGTACATAGTTAGATAGTTAGAATTATTATTAAGTAGCGGTTACAAAGTACGAGGACCAGAAGTGACAAAATGGA
AGTTGAAAACTACCTCAATAACCGAATGGATGTGTCTCTACACACACACCATTTCGAATCGGTACAAGGAAAAGAAGAAGAAGACGCGACGGTTGGAACGAGTGGACAAGATTCAACACA
CCTCTTCAAGATTCAATCTCAACCACATATCCAAGAGACGTGTCCTTTCACGAAGAGACGCAACTATTCACTCGTACCCGTAGGAAACTATAAATAGGGATAGTTAGATTCATTTGTACT
TGTTCATTACATTCGAAATCAATTGTATATACTCTCAATCGATATTGTATACATTCGGTTATTATCAAGTTATTCAAGTTGTTGTTATTCAAGTTATTCACGCTCATTTAGAGATCAAGA
TCCAAGTTCGGGCCAACAGCGTTTTTAGAAGTTTTTTTAACTTGTTTTGGTTTTTAGGGATTCTGCTACTGAAAGAGCAGACTCATTTTTTTGAGTTTTGTGATATGATGACTTCGCTTG
CCACGTGAACATCTGATGGTGTTAGATTTTTTTAGGGTCTGTTACCCTTTGTAGGGAACTCCCTAAAAACCAAAACGCTTCCAAAAACCTTCTAAAACATTTATCATCTTGCTAAAACAC
CAAAAAATAAAATAGAATCATGATATAGTAGGTTTTAAAATTAAAATTAGAAATTTACAGTCACTTTTAACACGTTTGACTCACTATATTTTTTTTTACTTGTTAGAACGAGACACAAAA
TATCGACCCATTCATAAATAAACAAACCAAATTAAAGCTCTCACCTCTAGCCAACGCATAATTTTATGCTGATCGTTTGTTTTTTTATATAGGTGGTCACACTATTGGAGTCGCTCATTG
TTCTTTATTTAAAGATCGTCTTTACAACTTCAATAACACCGGGGAACCAGACCCGACCATGGACTTAGGCCTGTTAACATGGCTGAGACTTGTATGTCCTCAAAATGCAACCGTTGATAG
CACGGCAAACTTGGATCAAAACTCTTCAACCTCTTCAACTGTGGACAACTCTTTCTACACTCAGATTATGTTGCATAGGGGAGTTCTTCAATTTGATCAAGAATTAGCATTGGACCCATT
GACCCAGTCAACAGTTGCAGCCATTGCTCATTCTGATGATTTTAACACCAAATTTGGTCAAGCCATGGTTAAGATGGGTGCGATCCAAGTTCTCACAGGAGAACAAGGACAGATAAGGAA
ATCATGCCGAGCAATCAACCTCTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGACAAACACTAAAGCAGCTGCACTAGCAGTTGGGTTCATCTTCTTGAACCTTACTTGTGTTCTTGGTGGTCTTCAGTATGGGTTCTATGATGGCAAGTGTGAAACTTCAGAT
GTTGAAGCCATCGTTAGAAACACGGTCTTCTCCGAGTTCCTCGTGGATCAAACAATCGCTCCTGCGCTGATTCGCATGCACTTCCATGATTGCTTTGTTAAT
GGTTGTGATGCATCGATT
CTACTTGACGGACACAACGCCGAAAAAACTGCACCGCCAAATTTAAGCGTTAGAGGTTTTGATGTGATTGATGCTGCAAAAGCCGCGGTTGAGGGGGTGTGCCCAGGGGTGGTTTCTTGT
GCTGATATAATTGCTATAGCTACAAGAGACGTTGTTGCCTTG
AGTGGTGGAGGTAGATATACTGTCCAAACAGGAAGAAGGGATGGACTTGTGTCTCTTGCCGAAAATACTATAGTACTC
CCTGCTCCTAATGCGTCCGTGTCAAGCGCGATTCATACTTTTGCGAGCAAAGGACTCACCGCCACCGACATGGTCTATCTTTCTG
GTGGTCACACTATTGGAGTCGCTCATTGTTCTTTA
TTTAAAGATCGTCTTTACAACTTCAATAACACCGGGGAACCAGACCCGACCATGGACTTAGGCCTGTTAACATGGCTGAGACTTGTATGTCCTCAAAATGCAACCGTTGATAGCACGGCA
AACTTGGATCAAAACTCTTCAACCTCTTCAACTGTGGACAACTCTTTCTACACTCAGATTATGTTGCATAGGGGAGTTCTTCAATTTGATCAAGAATTAGCATTGGACCCATTGACCCAG
TCAACAGTTGCAGCCATTGCTCATTCTGATGATTTTAACACCAAATTTGGTCAAGCCATGGTTAAGATGGGTGCGATCCAAGTTCTCACAGGAGAACAAGGACAGATAAGGAAATCATGC
CGAGCAATCAACCTCTA

Retrieve as FASTA