Entry information : HaPrx103 (HanXRQChr13g0419601)
Entry ID 13564
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx103 (HanXRQChr13g0419601)
Name (synonym) HaPrx103 (HanXRQChr13g0419601)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx103
start..stop
S start..stop
LsPrx07 529 0 1..292 1..295
HaPrx122 527 0 1..335 26..360
LperPrx07 495 3e-179 1..269 1..271
CiPrx06 471 9e-170 2..254 1..256
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 173434710..173434955 246 N° 2 173434441..173434620 180 N° 3 173433578..173433737 160 N° 4 173432981..173433402 422
complement(join(173432981..173433402,173433578..173433737,173434441..173434620,1 73434710..173434955))


exon

Literature and cross-references HaPrx103 (HanXRQChr13g0419601)
DNA ref. HanXRQ genome:   HanXRQChr13 (173434955..173432981)
Protein sequence: HaPrx103 (HanXRQChr13g0419601)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (311)
PWM (Da):   %s   36746.47 (34111.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.98 (7.98) Peptide Signal:   %s   cut: 25 range:25-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMREQWFPLFALAALGMVVSGTQAAIGLPPESAPLIRHFYKVHNTCANVEPFIRHQVQQVYANDKTVAPKLIKLLYADCMVNGCDASILLDGPNTEKESPKARGLGGFVLIDKIKQVLEARCPGAVSCADILNIAARDAVYFSGGPSYPVFLGRRDGLSSNAAWIDFPSPSISWESSLAYFESKGLDLQDMVTLLGAHMMGRVRCSNILDRLYNFNNTGKPDPTMEESTLSYLRNQCPPKTRLGQPNPLINLNPSNPDHRFTNSYYSQVLANKAVLGVDQQLRYGGDTYDLSDEYASSIQDFKLQFAFSMARMGGLKVITGTAGQIRLNCRAVNK

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAGAGAACAATGGTTTCCCCTTTTTGCATTGGCTGCTTTAGGTATGGTGGTTAGCGGTACTCAGGCGGCGATAGGGTTGCCGCCTGAGTCTGCACCACTAATCCGACACTTCTAC
AAGGTGCACAACACGTGTGCCAACGTGGAGCCATTTATTCGGCACCAGGTACAGCAAGTTTATGCTAATGACAAGACAGTTGCTCCAAAGCTCATCAAGTTGCTATATGCAGACTGCATG
GTTAAT
GTATGTCCTCTAATATGTATATGTTTATATGTATACGAAACACTTTTTTTTTGTGTTTTTAACTTAAGCTAATGAAAATGAAATAACAGGGGTGTGATGCATCGATTCTTCTAG
ACGGACCAAACACAGAAAAAGAATCACCAAAAGCGCGAGGACTAGGAGGATTCGTGCTTATTGACAAGATCAAGCAAGTCTTGGAAGCACGGTGCCCAGGAGCCGTTTCGTGTGCCGACA
TTCTCAACATTGCAGCCAGAGATGCCGTTTATTTT
GTAAGTGAAGTACCTTTCTTCTATTAATCATGATATACAACCCCTATATGCTTTGCAACTTAGTTCTAGACTTGACTTAGGGACG
TTTATGGTTCAGTTCGGCCGGTTTTGACAAAATTATGCTAAAGAGCTAACTAGACTTCGAAAAAAGCCAAACCAAACCAGCCAGGTTGGGTGAGTCGGCTGGTTTTGCGGTTCAGTTTCA
AACAATTTTTATACCCCCCCCCCCCTCCTCCTGGTTTGAAAAAGTAGTCTTCGAGAAACGCCAAACCAAACCGCCCAGGTGGGGTGAGTCGGCTGGTTTTGCGGGTCGGTTTTCAAGTTT
GAAGTTTTTTTTTTCTTATTTTTCAAAATCATTATTTTATATTAATATTTTTAAAATGATATAAATGTAGTAAGTTAATAAATATATATATATACAAAAACTACATATAATGAAACATAT
TTATAAAGAATATATGTTAAATGATCAGTTTGGTTTACACTGGTAACACGGATGGTTCCAAGTTTCAAACGAACCAAGCCGTTAAACCATCAAACATAGAAAACGAAACCCTCACTATTT
GAGTCTTAGACCGGCTAACTTGCTTTAGTTTGAACCGTTCGATCAGTTTCAAACTGTTTTTAAACAACCACCCCTCCCCCTCATTTGAAAAGTATGTTGAAGTGACTTTTAAGTCAACTT
TATATGAAATGTAAACAGTCTGGTGGTCCGTCGTACCCGGTTTTCTTGGGAAGAAGAGACGGACTTTCATCGAACGCAGCATGGATCGACTTTCCCTCGCCTTCCATTTCGTGGGAATCA
TCTTTGGCATACTTTGAATCTAAAGGTTTAGATCTGCAAGACATGGTTACACTCCTAG
GTAAGCCATCTATTCTAACAATATTGTTCCTTTATTTATAACACATCGATAATTACTTGCAA
GTCAAGCAAGCGAATATTATGATCACGAAAGACCAAACTCTAAATATTGTCAGAACCGCACTCTTTATTCAAACTTTTTTTTATAACTTCTCAATAAAATTTATAACTCTTAGGAGCACA
TATGATGGGAAGAGTTCGATGCAGTAACATTCTTGATCGCCTATACAACTTCAACAACACTGGAAAACCAGACCCCACAATGGAAGAATCTACATTGAGTTACTTAAGGAACCAATGCCC
TCCAAAGACGAGGTTGGGTCAACCCAACCCGCTCATAAACTTAAACCCAAGTAACCCGGACCATCGCTTTACCAACTCCTACTACTCGCAAGTGTTGGCCAATAAAGCTGTTTTAGGAGT
CGATCAACAGCTTCGCTATGGGGGTGACACTTATGATTTAAGCGATGAATATGCTTCGTCGATTCAAGATTTTAAGCTGCAGTTTGCTTTTTCAATGGCTAGGATGGGTGGGCTTAAGGT
TATAACCGGAACCGCCGGTCAGATCCGACTCAACTGTCGAGCGGTCAACAAATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAGAGAACAATGGTTTCCCCTTTTTGCATTGGCTGCTTTAGGTATGGTGGTTAGCGGTACTCAGGCGGCGATAGGGTTGCCGCCTGAGTCTGCACCACTAATCCGACACTTCTAC
AAGGTGCACAACACGTGTGCCAACGTGGAGCCATTTATTCGGCACCAGGTACAGCAAGTTTATGCTAATGACAAGACAGTTGCTCCAAAGCTCATCAAGTTGCTATATGCAGACTGCATG
GTTAAT
GGGTGTGATGCATCGATTCTTCTAGACGGACCAAACACAGAAAAAGAATCACCAAAAGCGCGAGGACTAGGAGGATTCGTGCTTATTGACAAGATCAAGCAAGTCTTGGAAGCA
CGGTGCCCAGGAGCCGTTTCGTGTGCCGACATTCTCAACATTGCAGCCAGAGATGCCGTTTATTTT
TCTGGTGGTCCGTCGTACCCGGTTTTCTTGGGAAGAAGAGACGGACTTTCATCG
AACGCAGCATGGATCGACTTTCCCTCGCCTTCCATTTCGTGGGAATCATCTTTGGCATACTTTGAATCTAAAGGTTTAGATCTGCAAGACATGGTTACACTCCTAG
GAGCACATATGATG
GGAAGAGTTCGATGCAGTAACATTCTTGATCGCCTATACAACTTCAACAACACTGGAAAACCAGACCCCACAATGGAAGAATCTACATTGAGTTACTTAAGGAACCAATGCCCTCCAAAG
ACGAGGTTGGGTCAACCCAACCCGCTCATAAACTTAAACCCAAGTAACCCGGACCATCGCTTTACCAACTCCTACTACTCGCAAGTGTTGGCCAATAAAGCTGTTTTAGGAGTCGATCAA
CAGCTTCGCTATGGGGGTGACACTTATGATTTAAGCGATGAATATGCTTCGTCGATTCAAGATTTTAAGCTGCAGTTTGCTTTTTCAATGGCTAGGATGGGTGGGCTTAAGGTTATAACC
GGAACCGCCGGTCAGATCCGACTCAACTGTCGAGCGGTCAACAAATAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTATC AGTTTTTGCA ATTAAGAGAG CTTGCTTGAT ATTATAACGA TGATGAGAGA ACAATGGTTT CCCCTTTTTG CATTGGCTGC TTTAGGTATG GTGGTTAGCG GTACTCAGGC  GGCGATAGGG TTGCCGCCTG AGTCTGCACC ACTAATCCGA CACTTCTACA AGGTGCACAA CACGTGTGCC AACGTGGAGC CATTTATTCG GCACCAGGTA CAGCAAGTTT ATGCTAATGA  CAAGACAGTT GCTCCAAAGC TCATCAAGTT GCTATATGCA GACTGCATGG TTAATGGGTG TGATGCATCG ATTCTTCTAG ACGGACCAAA CACAGAAAAA GAATCACCAA AAGCGCGAGG  ACTAGGAGGA TTCGTGCTTA TTGACAAGAT CAAGCAAGTC TTGGAAGCAC GGTGCCCAGG AGCCGTTTCG TGTGCCGACA TTCTCAACAT TGCAGCCAGA GATGCCGTTT ATTTTTCTGG  TGGTCCGTCG TACCCGGTTT TCTTGGGAAG AAGAGACGGA CTTTCATCGA ACGCAGCATG GATCGACTTT CCCTCGCCTT CCATTTCGTG GGAATCATCT TTGGCATACT TTGAATCTAA  AGGTTTAGAT CTGCAAGACA TGGTTACACT CCTAGGAGCA CATATGATGG GAAGAGTTCG ATGCAGTAAC ATTCTTGATC GCCTATACAA CTTCAACAAC ACTGGAAAAC CAGACCCCAC  AATGGAAGAA TCTACATTGA GTTACTTAAG GAACCAATGC CCTCCAAAGA CGAGGTTGGG TCAACCCAAC CCGCTCATAA ACTTAAACCC AAGTAACCCG GACCATCGCT TTACCAACTC  CTACTACTCG CAAGTGTTGG CCAATAAAGC TGTTTTAGGA GTCGATCAAC AGCTTCGCTA TGGGGGTGAC ACTTATGATT TAAGCGATGA ATATGCTTCG TCGATTCAAG ATTTTAAGCT  GCAGTTTGCT TTTTCAATGG CTAGGATGGG TGGGCTTAAG GTTATAACCG GAACCGCCGG TCAGATCCGA CTCAACTGTC GAGCGGTCAA CAAATAGATT GAATGTGGTT TATTTTGTTA  TAAATAAATA GTTGGATTGT GTTTCACTAA TGAAAATCAA AATCTAATTC TGTGTTGCTG ATATATAAGA GTTGTAATGA GTTCTTTAAT TCTATGTTGA CAAGTTGTAT ATTGCTTCAG 
TTATACGTTT TCAAACCG 

Retrieve as FASTA