Entry information : HaPrx105 (HanXRQChr14g0439141)
Entry ID 13566
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx105 (HanXRQChr14g0439141)
Name (synonym) HaPrx105 (HanXRQChr14g0439141)
Class Class III peroxidase    [Orthogroup: Prx038]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx105
start..stop
S start..stop
HaPrx99 519 0 31..360 11..340
HaPrx48 479 3e-171 21..360 3..340
LsePrx49 461 1e-164 25..326 1..304
MePrx118 452 1e-160 27..362 4..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 92234132..92234470 339 N° 2 92233087..92233836 750  
complement(join(92233087..92233836,92234132..92234470))


exon

Literature and cross-references HaPrx105 (HanXRQChr14g0439141)
DNA ref. HanXRQ genome:   HanXRQChr14 (92234470..92233087)
Protein sequence: HaPrx105 (HanXRQChr14g0439141)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362
PWM (Da):   %s   40651.56 Transmb domain:   %s   i27-45o
PI (pH):   %s   6.58
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSNKYIYTHKLTLSTLNLNHNSYTMKISSFIVTIIIISFSMSVFADDYSSIALKIPSLEDLSAIGDDLSYSFYHERCHDVEGIIYRKVKEWVYKEPTLAPSLLRLQYHDCVVRGCDASILLDHEGSEKTANASKSLRGFEVIDDIKAEIEKHCPRTVSCADILTAVARDATVLAGGPYWTVPYGRKDGRVSLAKEAEIVPKGSESVTNLIEFFQSKGLNVLDLVVLSGAHTIGRATCESVQHRLYDYKGTNKPDPSLDPKYLNYLRRKCRWASENVHLDGETPDTFDTQYYHNLKKNMGLLSTDQLLYTDSRTKPIATGLSYESLLFKNQFGVSMVKLASILDYTSQDDGEIRVDCKYVNQY*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAACAAGTATATATATACACACAAACTCACATTATCCACACTCAACTTAAATCACAACTCATACACAATGAAGATTTCTAGCTTCATCGTCACCATCATCATAATCTCTTTTTCC
ATGTCGGTTTTCGCCGATGATTACTCGTCAATAGCTCTTAAGATACCGTCCCTTGAAGACCTCTCCGCTATTGGAGACGATCTCTCCTACTCGTTCTACCACGAAAGATGTCACGATGTT
GAAGGCATCATCTATAGAAAGGTCAAGGAATGGGTTTACAAAGAGCCGACCCTTGCTCCGAGTCTCCTGAGGCTCCAATATCATGATTGCGTCGTTCGG
GTATATATCGATGATCTCTTT
TTTGTCAAAATATTTCAATATATTTCAAAAAGTACTGTTAATGATGGTGTTAGCGGAGTTTATTATCTATTATAGCTATTATTATCTGATTTATCATTGATTTTAGTCATTATTATACAT
CTTTTTGGAGTATTAGGACAATTATTGAGGTTTTATCGTTATCATTAGTTGGTTAGCTTAATTATTATCCTTTTCATTGTAAAGTACGTAGAAAATATTAATCACTAACACAGTTTTTCA
GTTCTTTTGAATTTGACAATATGTTTTGTTACAGGGATGTGATGCGTCCATTCTTTTGGATCATGAAGGAAGCGAGAAAACAGCGAACGCTAGCAAGTCGTTAAGAGGGTTTGAAGTGAT
CGATGACATAAAAGCCGAGATCGAGAAGCATTGCCCAAGAACCGTGTCTTGTGCTGACATTCTAACCGCTGTGGCTCGAGATGCCACAGTTTTAGCTGGTGGACCGTATTGGACGGTCCC
TTATGGTAGGAAAGATGGTCGAGTTTCGCTTGCTAAAGAGGCCGAGATAGTCCCCAAGGGTTCTGAAAGTGTTACTAACCTCATAGAGTTTTTCCAATCCAAGGGACTCAACGTCCTTGA
TCTAGTCGTCCTTTCAGGTGCCCACACGATTGGACGGGCCACATGCGAGTCAGTGCAACATCGGTTATATGACTACAAAGGAACAAACAAGCCTGACCCGTCGTTGGATCCAAAATATTT
GAACTATTTGAGGAGAAAGTGTAGATGGGCTTCTGAAAATGTGCATCTTGATGGTGAAACACCAGACACATTTGACACACAATACTACCACAACCTTAAGAAAAACATGGGCCTATTGTC
CACTGACCAATTGCTCTACACGGACTCGAGGACCAAACCCATCGCTACTGGTTTATCGTACGAATCCTTGCTGTTTAAAAACCAATTCGGCGTGTCAATGGTGAAGCTTGCGAGCATTCT
TGACTATACTTCTCAAGATGATGGTGAAATTCGTGTCGATTGCAAATATGTTAATCAGTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAACAAGTATATATATACACACAAACTCACATTATCCACACTCAACTTAAATCACAACTCATACACAATGAAGATTTCTAGCTTCATCGTCACCATCATCATAATCTCTTTTTCC
ATGTCGGTTTTCGCCGATGATTACTCGTCAATAGCTCTTAAGATACCGTCCCTTGAAGACCTCTCCGCTATTGGAGACGATCTCTCCTACTCGTTCTACCACGAAAGATGTCACGATGTT
GAAGGCATCATCTATAGAAAGGTCAAGGAATGGGTTTACAAAGAGCCGACCCTTGCTCCGAGTCTCCTGAGGCTCCAATATCATGATTGCGTCGTTCGG
GGATGTGATGCGTCCATTCTT
TTGGATCATGAAGGAAGCGAGAAAACAGCGAACGCTAGCAAGTCGTTAAGAGGGTTTGAAGTGATCGATGACATAAAAGCCGAGATCGAGAAGCATTGCCCAAGAACCGTGTCTTGTGCT
GACATTCTAACCGCTGTGGCTCGAGATGCCACAGTTTTAGCTGGTGGACCGTATTGGACGGTCCCTTATGGTAGGAAAGATGGTCGAGTTTCGCTTGCTAAAGAGGCCGAGATAGTCCCC
AAGGGTTCTGAAAGTGTTACTAACCTCATAGAGTTTTTCCAATCCAAGGGACTCAACGTCCTTGATCTAGTCGTCCTTTCAGGTGCCCACACGATTGGACGGGCCACATGCGAGTCAGTG
CAACATCGGTTATATGACTACAAAGGAACAAACAAGCCTGACCCGTCGTTGGATCCAAAATATTTGAACTATTTGAGGAGAAAGTGTAGATGGGCTTCTGAAAATGTGCATCTTGATGGT
GAAACACCAGACACATTTGACACACAATACTACCACAACCTTAAGAAAAACATGGGCCTATTGTCCACTGACCAATTGCTCTACACGGACTCGAGGACCAAACCCATCGCTACTGGTTTA
TCGTACGAATCCTTGCTGTTTAAAAACCAATTCGGCGTGTCAATGGTGAAGCTTGCGAGCATTCTTGACTATACTTCTCAAGATGATGGTGAAATTCGTGTCGATTGCAAATATGTTAAT
CAGTACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCATCTTAA TGTCAAACAA GTATATATAT ACACACAAAC TCACATTATC CACACTCAAC TTAAATCACA ACTCATACAC AATGAAGATT TCTAGCTTCA TCGTCACCAT CATCATAATC  TCTTTTTCCA TGTCGGTTTT CGCCGATGAT TACTCGTCAA TAGCTCTTAA GATACCGTCC CTTGAAGACC TCTCCGCTAT TGGAGACGAT CTCTCCTACT CGTTCTACCA CGAAAGATGT  CACGATGTTG AAGGCATCAT CTATAGAAAG GTCAAGGAAT GGGTTTACAA AGAGCCGACC CTTGCTCCGA GTCTCCTGAG GCTCCAATAT CATGATTGCG TCGTTCGGGG ATGTGATGCG  TCCATTCTTT TGGATCATGA AGGAAGCGAG AAAACAGCGA ACGCTAGCAA GTCGTTAAGA GGGTTTGAAG TGATCGATGA CATAAAAGCC GAGATCGAGA AGCATTGCCC AAGAACCGTG  TCTTGTGCTG ACATTCTAAC CGCTGTGGCT CGAGATGCCA CAGTTTTAGC TGGTGGACCG TATTGGACGG TCCCTTATGG TAGGAAAGAT GGTCGAGTTT CGCTTGCTAA AGAGGCCGAG  ATAGTCCCCA AGGGTTCTGA AAGTGTTACT AACCTCATAG AGTTTTTCCA ATCCAAGGGA CTCAACGTCC TTGATCTAGT CGTCCTTTCA GGTGCCCACA CGATTGGACG GGCCACATGC  GAGTCAGTGC AACATCGGTT ATATGACTAC AAAGGAACAA ACAAGCCTGA CCCGTCGTTG GATCCAAAAT ATTTGAACTA TTTGAGGAGA AAGTGTAGAT GGGCTTCTGA AAATGTGCAT  CTTGATGGTG AAACACCAGA CACATTTGAC ACACAATACT ACCACAACCT TAAGAAAAAC ATGGGCCTAT TGTCCACTGA CCAATTGCTC TACACGGACT CGAGGACCAA ACCCATCGCT  ACTGGTTTAT CGTACGAATC CTTGCTGTTT AAAAACCAAT TCGGCGTGTC AATGGTGAAG CTTGCGAGCA TTCTTGACTA TACTTCTCAA GATGATGGTG AAATTCGTGT CGATTGCAAA  TATGTTAATC AGTACTGATG AATGTCAGGA TATCTATCCG TAACGACTAA TAGTTTTTCC TTGCCAACTT CATGTGTTTG TTTCGCTTGT AATCTAATTT TTATTTAAAG ATCAAATATA 
ACTACAAAGT TACTTACTAT GATATTGATC AAAAAAACTT TCACAATTCA CA 

Retrieve as FASTA