Entry information : HaPrx109 (HanXRQChr16g0505171)
Entry ID 13570
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx109 (HanXRQChr16g0505171)
Name (synonym) HaPrx109 (HanXRQChr16g0505171)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx109
start..stop
S start..stop
LsaPrx38 501 0 1..291 1..290
CroPrx12 454 4e-162 6..323 5..330
LePrx37 454 9e-162 7..324 11..329
NtPrx36-1A 447 1e-159 9..323 11..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32360885..32361088 204 N° 2 32360512..32360703 192 N° 3 32359771..32359936 166 N° 4 32359014..32359426 413
complement(join(32359014..32359426,32359771..32359936,32360512..32360703,3236088 5..32361088))


exon

Literature and cross-references HaPrx109 (HanXRQChr16g0505171)
DNA ref. HanXRQ genome:   HanXRQChr16 (32361088..32359014)
Protein sequence: HaPrx109 (HanXRQChr16g0505171)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (303)
PWM (Da):   %s   35249.67 (32875.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.71 (7.31) Peptide Signal:   %s   cut: 22 range:22-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHQKNTSIIFLVFLSFLLANGQLNYYYYYSSCPNLQMIVKYGVWAAMKNDTRVAASLLRLHFHDCFVNGCDGSVLLDDTETFKGEKTAGPNINSVRGFEVIDNIKADVERACPSTVSCVDILTLAAREAVVLSGGPNWGVALGRRDGLTANLKAANTNLPSPFDPLEKMISKFTDVGLNLRDVVALSGAHTIGLAQCFTFKHRLFDYKGTGKPDPNLDSSLASSLKTACPNVAKSNTNLNSLDMVSTYMFDNAYYKNLVNNAGLLESDQALMSDPQSASIVKGYSMYPYLFFNDFATSMIKLGNIGVITGLNGEVRKKCGQINH

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCAAAAGAACACTAGCATCATTTTCTTAGTTTTTCTTTCATTTCTTTTAGCTAATGGCCAACTTAATTATTACTATTATTATTCATCATGTCCTAACTTACAAATGATAGTTAAA
TATGGTGTTTGGGCAGCCATGAAAAATGACACCAGGGTGGCTGCGTCTCTTCTTCGTCTTCATTTCCATGATTGTTTTGTTAAT
GTAATCATTTGAATTGTTTTAAGTTTCGCGTTATGC
ATCAGTATTGCTTTTTTTTTTTTTTTTTTTTTTGGGGGGGGGGGTGGGGGGTGGGGAATAAAGTTAACTGATCTCAAACACCCTCAAAACAACTTATTGTTGTATTAAAATGTAACAAGC
ATATTGTTTCCTGTTTTGTTTTTAGGGTTGTGATGGCTCTGTGCTTTTGGATGATACCGAAACCTTCAAGGGGGAAAAGACTGCAGGCCCGAATATTAATTCGGTTCGTGGGTTTGAAGT
TATAGACAATATAAAGGCTGATGTGGAACGGGCTTGCCCGTCGACCGTTTCATGTGTTGACATTTTGACTCTTGCAGCTAGAGAAGCTGTTGTTTTG
GTATGTTACAAGTTAAAACTTTT
GCAATATTTTTTTTTACTTGGTTTTAAGTAATGGGCCAAAACAAATTCAACTTAAAACAATGTACTTGTACGCTGGGGTGACAAGTACACACTTTTATGAAGAAATAGTTTTAAAATACA
GATAACTAATGATGATTTTGTAATTTAAAAAAAAAACTATTTTAAAATATAAAAAAAATAATGTTGATTTTGTAATTTATAGAAAAATATTGTTATAATTATTTATATCTTTGAATAAAA
CATATAAAAAAAATAATGTTGATTTTGTAATTTATAGAAAAATATTGTTATAATTATTTATATCTTTGAATAAAAGAACTTAAAAAGTTAGTTTTGTTAATTAATAAAAGAGACTTTAGG
CTATTTACTACCCAATCCATTTGACATGTTAGTTTTAGCAAAAATAAGTTTTTGACCATATGAGATGATACAAACAAATATTGACTCATAAGGGAAGTAAATGTGTCCAAATTGTCACTC
TACACTTTACTTATTTATGTTCTCCTTTACACCATTTTTGTGTTTTCTTAAAGTTTAATCATCTTTATACAGTCAGGAGGGCCAAACTGGGGCGTTGCACTAGGCCGTCGAGACGGTTTG
ACAGCAAACCTGAAAGCAGCAAACACGAACCTTCCATCACCATTTGATCCTCTAGAAAAGATGATCTCTAAGTTTACAGACGTAGGTCTCAATCTGAGGGATGTCGTCGCTCTCTCTG
GT
ACTAGCCATTTTACGTTTTTTAATAAATTTAGGTACCATTCTTCCTAGAGGTGGTAAAATGGGTAGCTTTGTCAGATGGTAACGAGTTAAACGAGTTCGAAGCAAAAAAAATATATTTGT
TGTCCTCATTGAAAATAACATTATTGTCCAAAAAGATTTAAAAAATTATAATCAGTAGTGTGCCAAATATGGCACAAAGCAAAATAACCAGCTTGTTGCTTTAAATAATTTTTTATTGTC
TATTATTTTACTGATTAGACCTGTTAGAAAGAAAAATAACTCAGATTCAAATATCTAGTTCTTTTGCACCACTAAAAAGGGTTCTCTTTTCATGGCTCATAGGTGCACACACTATCGGGC
TGGCTCAATGCTTCACATTCAAACACCGACTATTTGACTATAAAGGGACCGGTAAACCTGACCCGAATCTTGACTCATCTCTAGCCTCAAGCTTGAAAACCGCGTGTCCAAATGTTGCTA
AATCAAACACAAACCTTAACTCCTTAGACATGGTGAGTACATACATGTTTGATAACGCGTATTATAAAAACCTCGTCAACAATGCTGGATTACTTGAATCCGATCAAGCGCTAATGAGTG
ATCCACAAAGTGCTTCTATAGTCAAGGGTTATAGCATGTACCCGTATCTTTTTTTTAACGATTTTGCAACATCGATGATAAAACTCGGTAACATTGGGGTAATTACAGGGCTAAATGGTG
AAGTTAGAAAGAAATGTGGCCAGATCAATCATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCAAAAGAACACTAGCATCATTTTCTTAGTTTTTCTTTCATTTCTTTTAGCTAATGGCCAACTTAATTATTACTATTATTATTCATCATGTCCTAACTTACAAATGATAGTTAAA
TATGGTGTTTGGGCAGCCATGAAAAATGACACCAGGGTGGCTGCGTCTCTTCTTCGTCTTCATTTCCATGATTGTTTTGTTAAT
GGTTGTGATGGCTCTGTGCTTTTGGATGATACCGAA
ACCTTCAAGGGGGAAAAGACTGCAGGCCCGAATATTAATTCGGTTCGTGGGTTTGAAGTTATAGACAATATAAAGGCTGATGTGGAACGGGCTTGCCCGTCGACCGTTTCATGTGTTGAC
ATTTTGACTCTTGCAGCTAGAGAAGCTGTTGTTTTG
TCAGGAGGGCCAAACTGGGGCGTTGCACTAGGCCGTCGAGACGGTTTGACAGCAAACCTGAAAGCAGCAAACACGAACCTTCCA
TCACCATTTGATCCTCTAGAAAAGATGATCTCTAAGTTTACAGACGTAGGTCTCAATCTGAGGGATGTCGTCGCTCTCTCTG
GTGCACACACTATCGGGCTGGCTCAATGCTTCACATTC
AAACACCGACTATTTGACTATAAAGGGACCGGTAAACCTGACCCGAATCTTGACTCATCTCTAGCCTCAAGCTTGAAAACCGCGTGTCCAAATGTTGCTAAATCAAACACAAACCTTAAC
TCCTTAGACATGGTGAGTACATACATGTTTGATAACGCGTATTATAAAAACCTCGTCAACAATGCTGGATTACTTGAATCCGATCAAGCGCTAATGAGTGATCCACAAAGTGCTTCTATA
GTCAAGGGTTATAGCATGTACCCGTATCTTTTTTTTAACGATTTTGCAACATCGATGATAAAACTCGGTAACATTGGGGTAATTACAGGGCTAAATGGTGAAGTTAGAAAGAAATGTGGC
CAGATCAATCATTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATAC CACTCTAGTA GCCCATCCAA TAAACACACT TGATCTATAA ATTATTCTCC TCTTTTTGGC GTATAAATAG TCACATGGAT CTACCATGAA TCTTAACAAA AACCTTAATC  TCCTCAAAGT ATCATTTTCC ATTTAAGCCA ATATGCATCA AAAGAACACT AGCATCATTT TCTTAGTTTT TCTTTCATTT CTTTTAGCTA ATGGCCAACT TAATTATTAC TATTATTATT  CATCATGTCC TAACTTACAA ATGATAGTTA AATATGGTGT TTGGGCAGCC ATGAAAAATG ACACCAGGGT GGCTGCGTCT CTTCTTCGTC TTCATTTCCA TGATTGTTTT GTTAATGGTT  GTGATGGCTC TGTGCTTTTG GATGATACCG AAACCTTCAA GGGGGAAAAG ACTGCAGGCC CGAATATTAA TTCGGTTCGT GGGTTTGAAG TTATAGACAA TATAAAGGCT GATGTGGAAC  GGGCTTGCCC GTCGACCGTT TCATGTGTTG ACATTTTGAC TCTTGCAGCT AGAGAAGCTG TTGTTTTGTC AGGAGGGCCA AACTGGGGCG TTGCACTAGG CCGTCGAGAC GGTTTGACAG  CAAACCTGAA AGCAGCAAAC ACGAACCTTC CATCACCATT TGATCCTCTA GAAAAGATGA TCTCTAAGTT TACAGACGTA GGTCTCAATC TGAGGGATGT CGTCGCTCTC TCTGGTGCAC  ACACTATCGG GCTGGCTCAA TGCTTCACAT TCAAACACCG ACTATTTGAC TATAAAGGGA CCGGTAAACC TGACCCGAAT CTTGACTCAT CTCTAGCCTC AAGCTTGAAA ACCGCGTGTC  CAAATGTTGC TAAATCAAAC ACAAACCTTA ACTCCTTAGA CATGGTGAGT ACATACATGT TTGATAACGC GTATTATAAA AACCTCGTCA ACAATGCTGG ATTACTTGAA TCCGATCAAG  CGCTAATGAG TGATCCACAA AGTGCTTCTA TAGTCAAGGG TTATAGCATG TACCCGTATC TTTTTTTTAA CGATTTTGCA ACATCGATGA TAAAACTCGG TAACATTGGG GTAATTACAG  GGCTAAATGG TGAAGTTAGA AAGAAATGTG GCCAGATCAA TCATTAAGTT AATTGGATGT GGTGTTGCTA GATGGTTGAA AATAAGGGTT TGACTTTGAC CTTTGTTGTA CTTTGTATCA 
CTTGTATGTT AACCAAAAAG TAATATAAGG TCTTGATGTT TTACCCCCGG TAAAGAAATA TATTTAGCAT TTATTAACTA GATTTTGAGA AGAGTAAAT 

Retrieve as FASTA