Entry information : HaPrx113 (HanXRQChr16g0527371)
Entry ID 13574
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx113 (HanXRQChr16g0527371)
Name (synonym) HaPrx113 (HanXRQChr16g0527371)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx113
start..stop
S start..stop
HaPrx118 632 0 1..322 20..341
HaPrx116 627 0 1..322 20..341
HaPrx114 627 0 1..322 20..341
HaPrx119 622 0 1..322 20..341
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 164961882..164962100 219 N° 2 164960424..164960784 361 N° 3 164959927..164960315 389  
complement(join(164959927..164960315,164960424..164960784,164961882..164962100))


exon

Literature and cross-references HaPrx113 (HanXRQChr16g0527371)
DNA ref. HanXRQ genome:   HanXRQChr16 (164962100..164959927)
Protein sequence: HaPrx113 (HanXRQChr16g0527371)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (296)
PWM (Da):   %s   34656.56 (31812.1)  
PI (pH):   %s   7.56 (7.92) Peptide Signal:   %s   cut: 27 range:27-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASPNIITLIFFLLILCVINNTPCEAQLSSTFYDASCPNALRTIRTSIRTAISRERRMAASIVRLHFHDCFVQGCDASILLDDGPSIISEKNALPNKGSVRGYEVIEAAKSEVEKLCPGVVSCADVLTVAACDASEMVGGPSWSVKLRRRDSTTASLLLAESGALPSFKASLDSLISTFGDNGLSARDMVALSGAHTIGQAQCFLFRDRIYNNGSDIDAGFASTRRRRCPINDGNGNLAPLDLVTPNSFDYNYFKNLIQKKGLLESDPVLFSGGSTDSIVREYSNNPSKFKSDFTAAMVKVSEIRPLTGQEGVIRRICGALP

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCCAAATATTATTACACTTATCTTCTTCTTGCTAATTCTTTGTGTTATAAACAATACACCATGCGAAGCACAGTTATCTTCTACATTCTATGACGCTTCATGTCCCAATGCA
CTACGTACAATCAGGACATCCATCCGAACAGCCATATCTCGTGAGCGTCGCATGGCAGCTTCCATCGTTCGTCTCCACTTCCACGACTGCTTTGTTCAG
GTACTATCTTAACCATATACC
ATATCTGCAAGCAGGGGCGGATCTAGGTTTATACGTACGGGTTCACACGAACCCACTCGGTTTAAAATTACTAGTAGAAATGCTATTAAAAAAATCGGATTCACCCATAAATGATTTGAG
AGATGAACCCGCAGCAAAATTCCTCAAGCAGCGCAGTGGCTAAACATTAGCCTTTCTAATTTAGAAGTCATGTGTTCGAATCTTCTATTACTCATAAATATCATTTTAAGTCTTACCCCA
ACTTAACTAAGCAAACCCATTGGATAACTGAATACAATTATCCCATATTTGGGGTGGTGATTACAAATACAAACATATTATGTCATCAGTGTCTTTTTCTTCTTTTTTTTCATCTTGCAT
TGCACTCTTTGCTACTCACACTTAGTATTAACAATATTTCAATGGTTTTCGCTACATGTGTGATTCCTTCGATAACATGCAACTCTTTTAGGTAAAAGGTAACTATTTTGGTATTTAGAG
TACTATGCCACTATGCTAATATATGTTCATATATGTGTGTACATTCAAGTAGCGATGAGCTCGATACCGAGAGTACCGGTACCGAAAATCCCCAAAAGTGGGTACTGGTACCGGTATTTA
AGGGTAAAAACCGGTAAATACCCGACCGGTACCGAACCGGTATCGAAAATGTCAAAAGTCGGTACCGAAAATGTAACTGGTTCGGTAAATTCGGTACCAGTACCGGTTCGATACCGGTAC
CGGGTACCATTTGCTCATCCCCACATTCAAGCTTGTCATAAAGCTAGATCTTTTGCAAGTTACTTGATACTTATAATTTATTTTATTACAATGTGTATTTGTAAATACCATGGTATATAT
GTTACGTGTTTTATAATTTCTGATGATCATGTTCTTTATTATTGTATCGTATTTTTATTATGTGATGAACTTAACCTGACCCGAACCGTCAAACCGACTCGAATTTTTTTACGTCTGATC
CTATGAGATTGGAGCATCTATAAAGAATGAACCCACTGAAAAAAATTCCTGGATCCGCCACTGTCTACAAGATGTAAAAAGATAATTTGTAACGAGTTTTGTAACATTTAATGCAGGGTT
GTGACGCGTCTATCTTGCTAGATGACGGTCCTTCAATCATAAGTGAAAAGAATGCATTGCCTAATAAGGGTTCAGTAAGAGGTTATGAAGTGATAGAGGCAGCAAAATCTGAGGTTGAAA
AACTCTGTCCTGGAGTTGTATCATGTGCGGATGTACTAACCGTTGCTGCCTGTGATGCCTCAGAAATGGTTGGTGGTCCATCATGGTCTGTGAAGCTCCGAAGAAGAGACTCAACCACGG
CTAGCCTTCTTCTAGCAGAATCCGGTGCTCTTCCTAGTTTCAAAGCATCGCTAGACTCACTTATATCCACCTTTGGTGATAACGGGCTTAGTGCCAGGGACATGGTTGCATTATCAG
GTG
CTTATTTGCCGTATATGTAGCTTAATTAATTCATCGATTAATATATATTTTATTATATAAATTATAACAAAGTGTGAGCTAATATTGAAGATGTGGTTAATGCAGGAGCTCATACTATTG
GACAAGCGCAATGCTTCTTATTCCGTGATAGGATATACAACAACGGATCAGACATTGATGCAGGATTCGCTAGCACCCGTAGACGTCGTTGCCCTATCAACGACGGCAACGGAAATCTTG
CACCACTCGATTTAGTGACTCCTAATTCGTTTGATTATAATTACTTCAAGAACTTGATACAAAAGAAGGGTCTTCTTGAGTCTGATCCAGTGTTGTTTAGCGGTGGATCAACAGACAGCA
TTGTTAGGGAATATAGCAATAATCCTTCAAAGTTCAAGTCGGATTTTACAGCTGCAATGGTGAAGGTGAGTGAAATCAGGCCTTTAACAGGTCAAGAAGGAGTCATACGAAGAATTTGTG
GTGCTCTTCCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCCAAATATTATTACACTTATCTTCTTCTTGCTAATTCTTTGTGTTATAAACAATACACCATGCGAAGCACAGTTATCTTCTACATTCTATGACGCTTCATGTCCCAATGCA
CTACGTACAATCAGGACATCCATCCGAACAGCCATATCTCGTGAGCGTCGCATGGCAGCTTCCATCGTTCGTCTCCACTTCCACGACTGCTTTGTTCAG
GGTTGTGACGCGTCTATCTTG
CTAGATGACGGTCCTTCAATCATAAGTGAAAAGAATGCATTGCCTAATAAGGGTTCAGTAAGAGGTTATGAAGTGATAGAGGCAGCAAAATCTGAGGTTGAAAAACTCTGTCCTGGAGTT
GTATCATGTGCGGATGTACTAACCGTTGCTGCCTGTGATGCCTCAGAAATGGTTGGTGGTCCATCATGGTCTGTGAAGCTCCGAAGAAGAGACTCAACCACGGCTAGCCTTCTTCTAGCA
GAATCCGGTGCTCTTCCTAGTTTCAAAGCATCGCTAGACTCACTTATATCCACCTTTGGTGATAACGGGCTTAGTGCCAGGGACATGGTTGCATTATCAG
GAGCTCATACTATTGGACAA
GCGCAATGCTTCTTATTCCGTGATAGGATATACAACAACGGATCAGACATTGATGCAGGATTCGCTAGCACCCGTAGACGTCGTTGCCCTATCAACGACGGCAACGGAAATCTTGCACCA
CTCGATTTAGTGACTCCTAATTCGTTTGATTATAATTACTTCAAGAACTTGATACAAAAGAAGGGTCTTCTTGAGTCTGATCCAGTGTTGTTTAGCGGTGGATCAACAGACAGCATTGTT
AGGGAATATAGCAATAATCCTTCAAAGTTCAAGTCGGATTTTACAGCTGCAATGGTGAAGGTGAGTGAAATCAGGCCTTTAACAGGTCAAGAAGGAGTCATACGAAGAATTTGTGGTGCT
CTTCCCTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCC CAAATATTAT TACACTTATC TTCTTCTTGC TAATTCTTTG TGTTATAAAC AATACACCAT GCGAAGCACA GTTATCTTCT ACATTCTATG ACGCTTCATG TCCCAATGCA  CTACGTACAA TCAGGACATC CATCCGAACA GCCATATCTC GTGAGCGTCG CATGGCAGCT TCCATCGTTC GTCTCCACTT CCACGACTGC TTTGTTCAGG GTTGTGACGC GTCTATCTTG  CTAGATGACG GTCCTTCAAT CATAAGTGAA AAGAATGCAT TGCCTAATAA GGGTTCAGTA AGAGGTTATG AAGTGATAGA GGCAGCAAAA TCTGAGGTTG AAAAACTCTG TCCTGGAGTT  GTATCATGTG CGGATGTACT AACCGTTGCT GCCTGTGATG CCTCAGAAAT GGTTGGTGGT CCATCATGGT CTGTGAAGCT CCGAAGAAGA GACTCAACCA CGGCTAGCCT TCTTCTAGCA  GAATCCGGTG CTCTTCCTAG TTTCAAAGCA TCGCTAGACT CACTTATATC CACCTTTGGT GATAACGGGC TTAGTGCCAG GGACATGGTT GCATTATCAG GAGCTCATAC TATTGGACAA  GCGCAATGCT TCTTATTCCG TGATAGGATA TACAACAACG GATCAGACAT TGATGCAGGA TTCGCTAGCA CCCGTAGACG TCGTTGCCCT ATCAACGACG GCAACGGAAA TCTTGCACCA  CTCGATTTAG TGACTCCTAA TTCGTTTGAT TATAATTACT TCAAGAACTT GATACAAAAG AAGGGTCTTC TTGAGTCTGA TCCAGTGTTG TTTAGCGGTG GATCAACAGA CAGCATTGTT  AGGGAATATA GCAATAATCC TTCAAAGTTC AAGTCGGATT TTACAGCTGC AATGGTGAAG GTGAGTGAAA TCAGGCCTTT AACAGGTCAA GAAGGAGTCA TACGAAGAAT TTGTGGTGCT 
CTTCCCTAGT TATTTTGAAT GTCATCTAAA TCTTTTTTCG ATTACTTGGA AATT 

Retrieve as FASTA