Entry information : HaPrx[P]115 (HanXRQChr16g0527401)
Entry ID 13576
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx[P]115 (HanXRQChr16g0527401)
Name (synonym) HaPrx[P]115 (HanXRQChr16g0527401)
Class Class III peroxidase     [Orthogroup: Prx014]*
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx[P]115
start..stop
S start..stop
HaPrx116 375 2e-132 1..192 20..211
HaPrx114 375 2e-132 1..192 20..211
HaPrx118 375 2e-132 1..192 20..211
HaPrx113 374 2e-132 1..192 1..192
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 165037023..165037241 219 N° 2 165035464..165035925 462  
complement(join(165035464..165035925,165037023..165037241))


exon

Literature and cross-references HaPrx[P]115 (HanXRQChr16g0527401)
DNA ref. HanXRQ genome:   HanXRQChr16 (165037241..165035464)
Protein sequence: HaPrx[P]115 (HanXRQChr16g0527401)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   226
PWM (Da):   %s   24176.33  
PI (pH):   %s   7.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASPNIITLIFFLLILCVINNTPCEAQLSSTFYDASCPNALRTIRTSIRTAISRERRMAASIVRLHFHDCFVQGCDASILLDDGPSIISEKNALPNKGSVRGYEVIEAAKSEVEKLCPGVVSSADVLTVAARDASEMVGGPSWSVKLGRRDSTMASLLLAESGALPSFKASLDSLISTFGDNGLSARDMVALCWCTCVCTLSVFRHYITMSFVSLVSLTKATILLV*

Retrieve as FASTA  
Remarks Pseudogen from genomic (end of exon 1, exon 2 and 3). Pseudogenisation of tandem duplication.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCCAAATATTATTACACTTATCTTCTTCTTGCTAATTCTTTGTGTTATAAACAATACACCATGCGAAGCACAGTTATCTTCTACATTCTATGACGCTTCATGTCCCAATGCA
CTACGTACAATCAGGACATCCATCCGAACAGCCATATCTCGTGAGCGTCGCATGGCAGCTTCCATCGTTCGTCTCCACTTCCACGACTGCTTTGTTCAG
GTACTATCTTAACCATATACC
ATATCTGCAAGCAGGGGCGGATCTAGGTTTATACGTACGGGTTCACACGAACCCACTCGGTTTAAAATTACTAGTAGAAATGCTATTAAAAAAATCGGATTCACCCATAAATGATTTGAG
AGATGAACCCGCAGCAAAATTCCTCAAGCAGCGCAGTGGCTAAACATTAGCCTTTCTAATTTAGAAGTCATGTGTTCGAATCTTCTATTACTCATAAATATCATTTTAAGTCTTACCCCA
ACTTAACTAAGCAAACCCATTGGATAACTGAATACAATTATCCCATATTTGGGGTGGTGATTACAAATACAAACATATTATGTCATCAGTGTCTTTTTCTTCTTTTTTTTCATCTTGCAT
TGCACTCTTTGCTACTCACACTTAGTATTAACAATATTTCAATGGTTTTCGCTACATGTGTGATTCCTTCGATAACATGCAACTCTTTTAGGTAAAAGGTAACTATTTTGGTATTTAGAG
TACTATGCCACTATGCTAATATATGTTCATATATGTGTGTACATTCAAGTAGCGATGAGCTCGATACCGAGAGTACCGGTACCGAAAATCCCCAAAAGTGGGTACTGGTACCGGTATTTA
AGGGTAAAAACCGGTAAATACCCGACCGGTACCGAACCGGTATCGAAAATGTCAAAAGTCGGTACCGAAAATGTGACTGGTTCGGTAAATTCGGTACCAGTACCGGTTCGATACCGGTAC
CGGGTACCATTTGCTCATCCCCACATTCAAGCTTGTCATAAAGCTAGATCTTTTGCAAGTTACTTGATACTTATAATTTATTTTATTACAATGTGTATTTGTAAATACCATGGTATATAT
GTTACGTGTTTTATAATTTCTGATGATCATGTTCTTTATTATTGTATCGTATTTTTATTATGTGATGAACTTAACCTGACCCGAACCGTCAAACCGACTCGAATTTTTTTACGTCTGATC
CTATGAGATTGGAGCATCTATAAAGAATGAACCCACTGAAAAAAATTCCTGGATCCGCCACTCTCTGCAAGATGTAAAAAGATAATTTGTAACGAGTTTTGTAACATTTAATGCAGGGTT
GTGACGCGTCTATCTTGCTAGATGACGGCCCTTCAATCATAAGTGAAAAGAATGCATTGCCTAATAAGGGTTCAGTAAGAGGTTATGAAGTGATAGAGGCAGCAAAATCTGAGGTTGAAA
AACTCTGTCCTGGAGTTGTATCATCTGCGGATGTACTAACCGTTGCTGCCCGTGATGCCTCAGAAATGGTTGGTGGTCCATCATGGTCTGTGAAGCTCGGAAGAAGAGACTCAACCATGG
CTAGCCTTCTTCTAGCAGAATCCGGTGCTCTTCCTAGTTTCAAAGCATCGCTAGACTCACTTATATCCACCTTTGGTGATAACGGGCTTAGTGCCAGGGACATGGTTGCATTATGTTGGT
GCACTTGTGTCTGTACTTTGTCTGTATTCCGTCACTATATAACGATGTCCTTTGTTAGTCTTGTAAGTTTGACCAAGGCAACCATCCTCCTGGTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCCAAATATTATTACACTTATCTTCTTCTTGCTAATTCTTTGTGTTATAAACAATACACCATGCGAAGCACAGTTATCTTCTACATTCTATGACGCTTCATGTCCCAATGCA
CTACGTACAATCAGGACATCCATCCGAACAGCCATATCTCGTGAGCGTCGCATGGCAGCTTCCATCGTTCGTCTCCACTTCCACGACTGCTTTGTTCAG
GGTTGTGACGCGTCTATCTTG
CTAGATGACGGCCCTTCAATCATAAGTGAAAAGAATGCATTGCCTAATAAGGGTTCAGTAAGAGGTTATGAAGTGATAGAGGCAGCAAAATCTGAGGTTGAAAAACTCTGTCCTGGAGTT
GTATCATCTGCGGATGTACTAACCGTTGCTGCCCGTGATGCCTCAGAAATGGTTGGTGGTCCATCATGGTCTGTGAAGCTCGGAAGAAGAGACTCAACCATGGCTAGCCTTCTTCTAGCA
GAATCCGGTGCTCTTCCTAGTTTCAAAGCATCGCTAGACTCACTTATATCCACCTTTGGTGATAACGGGCTTAGTGCCAGGGACATGGTTGCATTATGTTGGTGCACTTGTGTCTGTACT
TTGTCTGTATTCCGTCACTATATAACGATGTCCTTTGTTAGTCTTGTAAGTTTGACCAAGGCAACCATCCTCCTGGTTTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCC CAAATATTAT TACACTTATC TTCTTCTTGC TAATTCTTTG TGTTATAAAC AATACACCAT GCGAAGCACA GTTATCTTCT ACATTCTATG ACGCTTCATG TCCCAATGCA  CTACGTACAA TCAGGACATC CATCCGAACA GCCATATCTC GTGAGCGTCG CATGGCAGCT TCCATCGTTC GTCTCCACTT CCACGACTGC TTTGTTCAGG GTTGTGACGC GTCTATCTTG  CTAGATGACG GCCCTTCAAT CATAAGTGAA AAGAATGCAT TGCCTAATAA GGGTTCAGTA AGAGGTTATG AAGTGATAGA GGCAGCAAAA TCTGAGGTTG AAAAACTCTG TCCTGGAGTT  GTATCATCTG CGGATGTACT AACCGTTGCT GCCCGTGATG CCTCAGAAAT GGTTGGTGGT CCATCATGGT CTGTGAAGCT CGGAAGAAGA GACTCAACCA TGGCTAGCCT TCTTCTAGCA  GAATCCGGTG CTCTTCCTAG TTTCAAAGCA TCGCTAGACT CACTTATATC CACCTTTGGT GATAACGGGC TTAGTGCCAG GGACATGGTT GCATTATGTT GGTGCACTTG TGTCTGTACT 
TTGTCTGTAT TCCGTCACTA TATAACGATG TCCTTTGTTA GTCTTGTAAG TTTGACCAAG GCAACCATCC TCCTGGTTTG A 

Retrieve as FASTA