Entry information : HaPrx119 (HanXRQChr16g0527451)
Entry ID 13580
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx119 (HanXRQChr16g0527451)
Name (synonym) HaPrx119 (HanXRQChr16g0527451)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx119
start..stop
S start..stop
HaPrx118 688 0 1..341 1..341
HaPrx116 682 0 1..341 1..341
HaPrx114 682 0 1..341 1..341
HaPrx113 622 0 20..341 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 165141087..165141362 276 N° 2 165140639..165140999 361 N° 3 165140142..165140530 389  
complement(join(165140142..165140530,165140639..165140999,165141087..165141362))


exon

Literature and cross-references HaPrx119 (HanXRQChr16g0527451)
DNA ref. HanXRQ genome:   HanXRQChr16 (165141362..165140142)
Protein sequence: HaPrx119 (HanXRQChr16g0527451)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341
PWM (Da):   %s   36906.63 Transmb domain:   %s   i12-34o
PI (pH):   %s   6.87
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPFYLHSIFQLLIINIFFQMASPNIITAIFFLLILCVTNNTPCDAQLSSTFYDASCPNALRTIRTSIRTAISRERRMAASILRLHFHDCFVQGCDASILLDDSPSIISEKNALPNKGSVRGYEVIEAAKSEVEKLCPGVVSCADVLTVAARDASEMVGGPSWSVKLGRRDSTSASLLLAESGALPSFKASLDSLISTFDDNGLSARDMVALSGAHTIGQAQCFLFRDRIYNNGSDIDAGFASTRRRGCPVNDGNGNLAPLDLVTPNSFDYTYFKNLIQKKGLLESDQVLFSGGSTDSIVREYSNNPSKFKSDFAAAMVKMSEIRTLTGQEGVIRRICGALP

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCTTTTATTTGCATTCCATCTTTCAACTTCTCATCATTAACATTTTTTTCCAAATGGCTTCCCCAAATATTATTACAGCTATCTTCTTCTTACTAATTCTTTGTGTTACAAACAAT
ACACCATGTGACGCACAGTTATCTTCTACATTCTATGACGCTTCATGTCCCAATGCACTACGTACAATCAGGACATCCATCCGAACAGCCATATCTCGTGAGCGTCGCATGGCAGCTTCG
ATCCTTCGTCTCCACTTCCATGACTGCTTTGTTCAG
GTACTATTTTAACCATATATATATGACCACCGTAGCTTCCAGATGTAAAAGGATAATTTGTAACGAGTTATGTATCATTTAATG
CAGGGTTGTGACGCGTCTATCTTGCTAGACGACAGTCCTTCAATCATAAGTGAAAAGAATGCGTTGCCTAATAAGGGTTCGGTAAGAGGTTATGAAGTGATAGAGGCAGCAAAATCTGAG
GTTGAAAAACTCTGTCCTGGAGTTGTATCATGTGCGGATGTACTAACCGTGGCTGCCCGTGATGCCTCAGAAATGGTTGGTGGTCCATCATGGTCTGTGAAGCTCGGAAGAAGAGACTCA
ACCTCGGCTAGCCTTCTTCTAGCAGAATCCGGTGCTCTTCCTAGTTTCAAAGCATCGCTAGACTCACTTATTTCCACCTTTGATGATAACGGGCTTAGTGCCCGGGACATGGTTGCATTA
TCAG
GTGCTTATTTGCCGTATATGTAGCTTAATTAATTCATCGATTAATATATATTTTATTGTATAAATTATAACAAAGTGTGAGCTAATATTGAAGATGTGGTTAATGCAGGAGCTCAT
ACTATTGGACAAGCGCAATGCTTCTTATTCCGTGATAGGATATACAACAACGGATCAGATATTGATGCAGGATTTGCTAGCACGCGTAGACGTGGATGCCCTGTCAACGACGGCAACGGA
AATCTTGCACCACTCGATTTAGTGACACCTAATTCGTTTGATTATACTTACTTCAAGAACTTGATACAAAAGAAGGGTCTTCTTGAGTCTGATCAAGTGTTGTTTAGCGGAGGATCAACA
GACAGCATTGTTAGAGAATATAGCAATAATCCTTCAAAGTTCAAGTCGGATTTTGCAGCTGCAATGGTGAAGATGAGTGAAATCAGGACTTTAACAGGTCAAGAAGGAGTCATACGAAGA
ATTTGTGGTGCTCTTCCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCTTTTATTTGCATTCCATCTTTCAACTTCTCATCATTAACATTTTTTTCCAAATGGCTTCCCCAAATATTATTACAGCTATCTTCTTCTTACTAATTCTTTGTGTTACAAACAAT
ACACCATGTGACGCACAGTTATCTTCTACATTCTATGACGCTTCATGTCCCAATGCACTACGTACAATCAGGACATCCATCCGAACAGCCATATCTCGTGAGCGTCGCATGGCAGCTTCG
ATCCTTCGTCTCCACTTCCATGACTGCTTTGTTCAG
GGTTGTGACGCGTCTATCTTGCTAGACGACAGTCCTTCAATCATAAGTGAAAAGAATGCGTTGCCTAATAAGGGTTCGGTAAGA
GGTTATGAAGTGATAGAGGCAGCAAAATCTGAGGTTGAAAAACTCTGTCCTGGAGTTGTATCATGTGCGGATGTACTAACCGTGGCTGCCCGTGATGCCTCAGAAATGGTTGGTGGTCCA
TCATGGTCTGTGAAGCTCGGAAGAAGAGACTCAACCTCGGCTAGCCTTCTTCTAGCAGAATCCGGTGCTCTTCCTAGTTTCAAAGCATCGCTAGACTCACTTATTTCCACCTTTGATGAT
AACGGGCTTAGTGCCCGGGACATGGTTGCATTATCAG
GAGCTCATACTATTGGACAAGCGCAATGCTTCTTATTCCGTGATAGGATATACAACAACGGATCAGATATTGATGCAGGATTT
GCTAGCACGCGTAGACGTGGATGCCCTGTCAACGACGGCAACGGAAATCTTGCACCACTCGATTTAGTGACACCTAATTCGTTTGATTATACTTACTTCAAGAACTTGATACAAAAGAAG
GGTCTTCTTGAGTCTGATCAAGTGTTGTTTAGCGGAGGATCAACAGACAGCATTGTTAGAGAATATAGCAATAATCCTTCAAAGTTCAAGTCGGATTTTGCAGCTGCAATGGTGAAGATG
AGTGAAATCAGGACTTTAACAGGTCAAGAAGGAGTCATACGAAGAATTTGTGGTGCTCTTCCCTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCGATTAAAC ACTATATAAG CCTCCTTCAT GCCCTTTTAT TTGCATTCCA TCTTTCAACT TCTCATCATT AACATTTTTT TCCAAATGGC TTCCCCAAAT ATTATTACAG CTATCTTCTT  CTTACTAATT CTTTGTGTTA CAAACAATAC ACCATGTGAC GCACAGTTAT CTTCTACATT CTATGACGCT TCATGTCCCA ATGCACTACG TACAATCAGG ACATCCATCC GAACAGCCAT  ATCTCGTGAG CGTCGCATGG CAGCTTCGAT CCTTCGTCTC CACTTCCATG ACTGCTTTGT TCAGGGTTGT GACGCGTCTA TCTTGCTAGA CGACAGTCCT TCAATCATAA GTGAAAAGAA  TGCGTTGCCT AATAAGGGTT CGGTAAGAGG TTATGAAGTG ATAGAGGCAG CAAAATCTGA GGTTGAAAAA CTCTGTCCTG GAGTTGTATC ATGTGCGGAT GTACTAACCG TGGCTGCCCG  TGATGCCTCA GAAATGGTTG GTGGTCCATC ATGGTCTGTG AAGCTCGGAA GAAGAGACTC AACCTCGGCT AGCCTTCTTC TAGCAGAATC CGGTGCTCTT CCTAGTTTCA AAGCATCGCT  AGACTCACTT ATTTCCACCT TTGATGATAA CGGGCTTAGT GCCCGGGACA TGGTTGCATT ATCAGGAGCT CATACTATTG GACAAGCGCA ATGCTTCTTA TTCCGTGATA GGATATACAA  CAACGGATCA GATATTGATG CAGGATTTGC TAGCACGCGT AGACGTGGAT GCCCTGTCAA CGACGGCAAC GGAAATCTTG CACCACTCGA TTTAGTGACA CCTAATTCGT TTGATTATAC  TTACTTCAAG AACTTGATAC AAAAGAAGGG TCTTCTTGAG TCTGATCAAG TGTTGTTTAG CGGAGGATCA ACAGACAGCA TTGTTAGAGA ATATAGCAAT AATCCTTCAA AGTTCAAGTC 
GGATTTTGCA GCTGCAATGG TGAAGATGAG TGAAATCAGG ACTTTAACAG GTCAAGAAGG AGTCATACGA AGAATTTGTG GTGCTCTTCC CTAG 

Retrieve as FASTA