Entry information : HaPrx120 (HanXRQChr16g0528201)
Entry ID 13581
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx120 (HanXRQChr16g0528201)
Name (synonym) HaPrx120 (HanXRQChr16g0528201)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx120
start..stop
S start..stop
LsaPrx20 479 2e-172 1..294 1..296
RcPrx77 436 4e-155 12..321 10..323
PtPrx24 434 2e-154 12..321 11..322
PtPrx23 430 6e-153 12..321 11..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 168226545..168226769 225 N° 2 168226906..168227088 183 N° 3 168227187..168227349 163 N° 4 168227832..168228226 395
join(168226545..168226769,168226906..168227088,168227187..168227349,168227832..1 68228226)


exon

Literature and cross-references HaPrx120 (HanXRQChr16g0528201)
DNA ref. HanXRQ genome:   HanXRQChr16 (168226545..168228226)
Protein sequence: HaPrx120 (HanXRQChr16g0528201)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (293)
PWM (Da):   %s   34613.47 (31388.7)  
PI (pH):   %s   8.21 (8.21) Peptide Signal:   %s   cut: 29 range:29-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPHQSLRTIFVFVTILILSLNNMEIKAQLSPTFYDTTCPNALTTIRTSIRTAVSRQRRMAALLIRLHFHDCFVQGCDASILLNDPATTERTALSNTGVGGYDVIDSAKSAVENICPGIVSCADILAVAARDASVAVGGPSWSVRLGRRDSTRANRALADGLPRADQDLPSLIRDFDAKGLNERDMVALSGSHTIGQSRCVAFRARIYSNASDIDANFASTRRRNCPANRGNGDGNLSPLDLVTPNSFDNNYFRNLVQRRGLLQSDQVLFNGGSTDSIVLEYSNNPRRFASDFAAAMVKMGEIELLTGANGVIRTSCSAAN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTCATCAATCTCTCCGAACCATTTTTGTTTTTGTCACCATTTTAATTCTTTCATTAAACAATATGGAGATCAAAGCTCAGTTGTCTCCTACTTTTTATGATACCACATGCCCC
AATGCACTCACCACCATTAGAACTTCTATTAGAACCGCAGTCTCTCGTCAACGTCGCATGGCTGCCCTTCTTATTCGCCTTCATTTTCACGATTGTTTCGTTCAG
GTTCGTTCAATATTT
TCCCCTTTGATGCTTGACCATCGGGCCCCACTACAACATGTGTGTCAAATGTGTGTCACACTTATAAACGTCTAAAATATGTTAAACTTGTTGCACTTATGTAAAAACATATAATTTGCA
GGGTTGTGATGCATCCATTTTACTAAACGATCCCGCCACAACTGAGAGGACAGCATTGTCCAATACCGGGGTTGGAGGATATGACGTTATAGATTCAGCAAAATCTGCTGTTGAAAACAT
TTGTCCGGGGATAGTTTCATGTGCGGATATACTTGCTGTCGCAGCGCGTGATGCTTCTGTTGCG
GTAACATATGTTCTAACTATATATATTTTTTTAATATTGAGTTAAAATCTTGTGTA
TCTTTGTATTGATCAGTTGTGAATAATTTGAAAAATATTCAGGTGGGTGGTCCTTCATGGTCAGTAAGACTTGGCAGAAGAGACTCTACTAGAGCGAACCGAGCGCTAGCTGATGGTCTT
CCACGAGCTGACCAGGATCTACCATCACTAATTAGAGATTTTGATGCAAAGGGTCTGAATGAAAGAGACATGGTTGCTTTATCTG
GTTAGAATTTATACACTTATACCTTATTTGTTGCC
AAATGTGTAAGCTAAATGTTTGTTATGTAGGGAATTTTTATAAAAAAAAAAAAAAAAACAAACTTTAGTCCAGTTTGTATTTTAAGGTGGCATGCTACAATTTTTTTTATTGAGCATGCG
CAATGAACACTTGTGGGGACTCCACAAACAGTCGTGTGGCCTCACGGACGGACAACCCACAAACACCCACATTGCGTGGGTTCGTCCATCGCGTTTTGGATGGCGTGGACGGACCCACAG
ACGGGCAAGGCCAGCCCCCAATATTTTAATTTCTTTTTCATTTTTTATATTGAGTTATGTATACTAAACTTTAATGGTTTTTGCGCCTAAGAAAACTCGTTACTTAAAACATAAAATATG
TAATGAAATATAGTTTGGCTACTTGTTTATGTAGTTAATCATTTTCTATATCTCTTTTGTGACACAAGCTATGTTTTGAATAATCAGGGTCTCATACTATTGGCCAATCGCGGTGTGTTG
CATTTCGAGCCAGGATATATAGTAACGCGTCGGACATAGATGCCAATTTCGCTAGCACGCGTAGGCGCAACTGCCCCGCAAATAGAGGAAATGGAGATGGAAACTTGTCACCACTTGATT
TGGTGACACCAAATTCATTTGATAACAATTACTTCAGGAATCTTGTTCAGAGGAGAGGCCTTCTTCAGTCAGACCAGGTACTGTTTAATGGTGGCTCAACCGATAGCATTGTGTTAGAGT
ATAGCAACAATCCAAGAAGATTTGCATCCGATTTCGCTGCAGCCATGGTTAAAATGGGAGAAATTGAGCTTCTTACTGGTGCTAATGGAGTCATAAGAACTTCTTGCAGTGCTGCCAATT
AA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTCATCAATCTCTCCGAACCATTTTTGTTTTTGTCACCATTTTAATTCTTTCATTAAACAATATGGAGATCAAAGCTCAGTTGTCTCCTACTTTTTATGATACCACATGCCCC
AATGCACTCACCACCATTAGAACTTCTATTAGAACCGCAGTCTCTCGTCAACGTCGCATGGCTGCCCTTCTTATTCGCCTTCATTTTCACGATTGTTTCGTTCAG
GGTTGTGATGCATCC
ATTTTACTAAACGATCCCGCCACAACTGAGAGGACAGCATTGTCCAATACCGGGGTTGGAGGATATGACGTTATAGATTCAGCAAAATCTGCTGTTGAAAACATTTGTCCGGGGATAGTT
TCATGTGCGGATATACTTGCTGTCGCAGCGCGTGATGCTTCTGTTGCG
GTGGGTGGTCCTTCATGGTCAGTAAGACTTGGCAGAAGAGACTCTACTAGAGCGAACCGAGCGCTAGCTGAT
GGTCTTCCACGAGCTGACCAGGATCTACCATCACTAATTAGAGATTTTGATGCAAAGGGTCTGAATGAAAGAGACATGGTTGCTTTATCTG
GGTCTCATACTATTGGCCAATCGCGGTGT
GTTGCATTTCGAGCCAGGATATATAGTAACGCGTCGGACATAGATGCCAATTTCGCTAGCACGCGTAGGCGCAACTGCCCCGCAAATAGAGGAAATGGAGATGGAAACTTGTCACCACTT
GATTTGGTGACACCAAATTCATTTGATAACAATTACTTCAGGAATCTTGTTCAGAGGAGAGGCCTTCTTCAGTCAGACCAGGTACTGTTTAATGGTGGCTCAACCGATAGCATTGTGTTA
GAGTATAGCAACAATCCAAGAAGATTTGCATCCGATTTCGCTGCAGCCATGGTTAAAATGGGAGAAATTGAGCTTCTTACTGGTGCTAATGGAGTCATAAGAACTTCTTGCAGTGCTGCC
AATTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACACAAAATT ACAAACCAAG TTTTCATTTA ACCACATGGA TCCTCATCAA TCTCTCCGAA CCATTTTTGT TTTTGTCACC ATTTTAATTC TTTCATTAAA CAATATGGAG ATCAAAGCTC  AGTTGTCTCC TACTTTTTAT GATACCACAT GCCCCAATGC ACTCACCACC ATTAGAACTT CTATTAGAAC CGCAGTCTCT CGTCAACGTC GCATGGCTGC CCTTCTTATT CGCCTTCATT  TTCACGATTG TTTCGTTCAG GGTTGTGATG CATCCATTTT ACTAAACGAT CCCGCCACAA CTGAGAGGAC AGCATTGTCC AATACCGGGG TTGGAGGATA TGACGTTATA GATTCAGCAA  AATCTGCTGT TGAAAACATT TGTCCGGGGA TAGTTTCATG TGCGGATATA CTTGCTGTCG CAGCGCGTGA TGCTTCTGTT GCGGTGGGTG GTCCTTCATG GTCAGTAAGA CTTGGCAGAA  GAGACTCTAC TAGAGCGAAC CGAGCGCTAG CTGATGGTCT TCCACGAGCT GACCAGGATC TACCATCACT AATTAGAGAT TTTGATGCAA AGGGTCTGAA TGAAAGAGAC ATGGTTGCTT  TATCTGGGTC TCATACTATT GGCCAATCGC GGTGTGTTGC ATTTCGAGCC AGGATATATA GTAACGCGTC GGACATAGAT GCCAATTTCG CTAGCACGCG TAGGCGCAAC TGCCCCGCAA  ATAGAGGAAA TGGAGATGGA AACTTGTCAC CACTTGATTT GGTGACACCA AATTCATTTG ATAACAATTA CTTCAGGAAT CTTGTTCAGA GGAGAGGCCT TCTTCAGTCA GACCAGGTAC  TGTTTAATGG TGGCTCAACC GATAGCATTG TGTTAGAGTA TAGCAACAAT CCAAGAAGAT TTGCATCCGA TTTCGCTGCA GCCATGGTTA AAATGGGAGA AATTGAGCTT CTTACTGGTG 
CTAATGGAGT CATAAGAACT TCTTGCAGTG CTGCCAATTA AAAAACAGAA GTTTATGTTT ATTCA 

Retrieve as FASTA