Entry information : HaPrx122 (HanXRQChr17g0538871)
Entry ID 13583
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx122 (HanXRQChr17g0538871)
Name (synonym) HaPrx122 (HanXRQChr17g0538871)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx122
start..stop
S start..stop
HaPrx103 527 0 26..360 1..335
LsPrx07 473 1e-169 26..317 1..295
LperPrx07 428 3e-152 26..294 2..271
GrPrx02 422 6e-149 26..360 1..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18542500..18542820 321 N° 2 18542085..18542264 180 N° 3 18541818..18541977 160 N° 4 18540780..18541201 422
complement(join(18540780..18541201,18541818..18541977,18542085..18542264,1854250 0..18542820))


exon

Literature and cross-references HaPrx122 (HanXRQChr17g0538871)
DNA ref. HanXRQ genome:   HanXRQChr17 (18542820..18540780)
Protein sequence: HaPrx122 (HanXRQChr17g0538871)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360
PWM (Da):   %s   39919.35 Transmb domain:   %s   i30-52o
PI (pH):   %s   9.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFTITMHFHQRYTYFSICTYQGYKKMKREGSLFLSFIVILAVCGAGVEATGLLPPESTPLIRHYYKVHNTCANVEPFVRHQVKSLYDKDKTIAPKLIKLLYADCMVNGCDASILLDGDNTEKKSPKNRGLAAFAVIDIAKKVIEARCPGVVSCADILNIAVRDAVYFSGGPSYPVFLGRRDGRKSDAAWVDLPSPSISWESALKYFTDKGLNLQDMVTLLGGHMMGRTRCSNILDRLYDFNKTGKPDPTMEPTTLSILQKQCPKKVKLGQPNPLINLNPDNPTHKFTNSYYSRVLASKSVLGVDQQLLYGTDTHDLTDEYANGLEDFKGGFAYSMSRMGGLKVLTGKNGEIRKNCHVVNK

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTACAATCACCATGCACTTTCATCAAAGATATACATATTTTTCAATCTGTACGTATCAAGGATATAAGAAGATGAAGAGAGAAGGTTCTCTATTTCTCTCTTTTATAGTAATTTTG
GCGGTTTGCGGTGCTGGGGTGGAGGCAACGGGATTATTGCCTCCAGAGTCAACACCGTTGATCCGCCATTACTACAAGGTTCATAATACATGTGCCAATGTTGAACCTTTTGTTCGACAC
CAAGTGAAGTCTTTATATGACAAGGACAAGACCATAGCCCCCAAGCTTATTAAATTGTTGTATGCTGATTGCATGGTTAAT
GTAAGTTGTTCTTGTTACTTGTTCTAAAGGAATACCGGA
TTTTAATAATCTCAATTATTAGCCGTTGGTCGGCAACTGTCCCAACTTAAAAAATAACCAGTCATTGTCCCACTTTTTCACATATTGTAACAATATGTGAAAAGGTGAGGCTACCACTGG
TCATTTTTGAACAGCTAATAGTTTTATAAGTAACATGATTTAAATTACGAGCCGGAATGTGTGAAATTAACTATAGGGGTGTGATGCATCGATTTTGTTGGATGGTGACAACACGGAGAA
AAAATCGCCTAAGAACCGCGGACTAGCCGCGTTTGCAGTGATTGACATAGCGAAAAAGGTTATTGAAGCAAGATGTCCTGGAGTAGTCTCGTGTGCTGATATTCTTAATATTGCTGTTAG
AGATGCTGTTTACTTT
GTAAGTACTTTTAACTAACTATTATTCTCACCATATATGTTGTACTTAGATATGTTTTACAAGGATCTAAAGTTTCATTTTACATGTTTTATAATTGAAATTTG
AAGTCGGGTGGACCGTCATACCCAGTTTTCTTGGGAAGAAGAGACGGGAGGAAATCGGATGCTGCGTGGGTTGATCTACCCTCGCCGTCGATCTCGTGGGAATCAGCTCTCAAATACTTC
ACAGATAAAGGTTTAAATTTGCAAGACATGGTTACACTTCTAG
GTATGTTGCTAGTGTCAGGACCCAATAATTAATTTACTCAGTCACAATGTTTTGGTATTCAGATGTACTAGACAGGC
CCCGACTCAAAATATTGTAAGCCCAAAGCAGATATTAAAATTAAGGCTCTTTTCGTAAAAAATAAAAAGAAAAAAAAATACTTTAGATCCTATGATTCTGTGTATACATAATTATAGATC
ATAAACCTCAATGTCAACAATCTTATAGTCAAAGTTACCTACATATGATATGTTTTTTTTTTTTTTTTTTTTAATTTGGGGTCATAGGGAAGTGGGGCCCAAAATGCTTGTTTTATTTCT
CTCCCCTTGAGCGAGCGGCCCTAGTACTAGAAACATATATCAAAAGGTTAACAATGTATACTTTCGGATCAAGAAATACATTGCATAAAAATTATATCTCAATTCAATTCATGCTAAAAG
TATAAAAATAACTTTAAAATCCTAAAAGTTATGGTATTTTAATAGTTAGTTTTATTGAAAGCAAGTTTTGATGATGTAAACTGCTTATGTGGTTGCAAGTTCTAGCAATCCTTACATTGC
GGTTTCACTATGATATTATTTCTGACCTCTTTTATATGTTTGTTTTTGGGTGGTTTTAGGAGGACATATGATGGGCCGAACTCGTTGTAGCAACATCTTAGACCGACTATACGACTTCAA
CAAAACAGGGAAACCCGACCCGACAATGGAACCAACCACATTAAGCATCTTACAAAAGCAATGTCCCAAGAAGGTGAAGTTGGGCCAGCCCAATCCTCTTATAAACTTGAACCCGGATAA
CCCAACACACAAGTTTACCAATTCTTACTACTCAAGAGTGTTGGCAAGTAAATCTGTTCTAGGGGTTGACCAACAACTATTGTATGGTACTGACACACATGATCTAACCGATGAATATGC
TAATGGGCTTGAAGACTTTAAGGGTGGATTCGCTTACTCGATGAGCCGGATGGGGGGACTCAAGGTTCTTACCGGAAAGAACGGTGAAATACGAAAGAATTGTCATGTTGTTAACAAGTA
G

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTACAATCACCATGCACTTTCATCAAAGATATACATATTTTTCAATCTGTACGTATCAAGGATATAAGAAGATGAAGAGAGAAGGTTCTCTATTTCTCTCTTTTATAGTAATTTTG
GCGGTTTGCGGTGCTGGGGTGGAGGCAACGGGATTATTGCCTCCAGAGTCAACACCGTTGATCCGCCATTACTACAAGGTTCATAATACATGTGCCAATGTTGAACCTTTTGTTCGACAC
CAAGTGAAGTCTTTATATGACAAGGACAAGACCATAGCCCCCAAGCTTATTAAATTGTTGTATGCTGATTGCATGGTTAAT
GGGTGTGATGCATCGATTTTGTTGGATGGTGACAACACG
GAGAAAAAATCGCCTAAGAACCGCGGACTAGCCGCGTTTGCAGTGATTGACATAGCGAAAAAGGTTATTGAAGCAAGATGTCCTGGAGTAGTCTCGTGTGCTGATATTCTTAATATTGCT
GTTAGAGATGCTGTTTACTTT
TCGGGTGGACCGTCATACCCAGTTTTCTTGGGAAGAAGAGACGGGAGGAAATCGGATGCTGCGTGGGTTGATCTACCCTCGCCGTCGATCTCGTGGGAA
TCAGCTCTCAAATACTTCACAGATAAAGGTTTAAATTTGCAAGACATGGTTACACTTCTAG
GAGGACATATGATGGGCCGAACTCGTTGTAGCAACATCTTAGACCGACTATACGACTTC
AACAAAACAGGGAAACCCGACCCGACAATGGAACCAACCACATTAAGCATCTTACAAAAGCAATGTCCCAAGAAGGTGAAGTTGGGCCAGCCCAATCCTCTTATAAACTTGAACCCGGAT
AACCCAACACACAAGTTTACCAATTCTTACTACTCAAGAGTGTTGGCAAGTAAATCTGTTCTAGGGGTTGACCAACAACTATTGTATGGTACTGACACACATGATCTAACCGATGAATAT
GCTAATGGGCTTGAAGACTTTAAGGGTGGATTCGCTTACTCGATGAGCCGGATGGGGGGACTCAAGGTTCTTACCGGAAAGAACGGTGAAATACGAAAGAATTGTCATGTTGTTAACAAG
TAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCTATATATA TGATACCTAC ATGTTTACAA TCACCATGCA CTTTCATCAA AGATATACAT ATTTTTCAAT CTGTACGTAT CAAGGATATA AGAAGATGAA GAGAGAAGGT TCTCTATTTC  TCTCTTTTAT AGTAATTTTG GCGGTTTGCG GTGCTGGGGT GGAGGCAACG GGATTATTGC CTCCAGAGTC AACACCGTTG ATCCGCCATT ACTACAAGGT TCATAATACA TGTGCCAATG  TTGAACCTTT TGTTCGACAC CAAGTGAAGT CTTTATATGA CAAGGACAAG ACCATAGCCC CCAAGCTTAT TAAATTGTTG TATGCTGATT GCATGGTTAA TGGGTGTGAT GCATCGATTT  TGTTGGATGG TGACAACACG GAGAAAAAAT CGCCTAAGAA CCGCGGACTA GCCGCGTTTG CAGTGATTGA CATAGCGAAA AAGGTTATTG AAGCAAGATG TCCTGGAGTA GTCTCGTGTG  CTGATATTCT TAATATTGCT GTTAGAGATG CTGTTTACTT TTCGGGTGGA CCGTCATACC CAGTTTTCTT GGGAAGAAGA GACGGGAGGA AATCGGATGC TGCGTGGGTT GATCTACCCT  CGCCGTCGAT CTCGTGGGAA TCAGCTCTCA AATACTTCAC AGATAAAGGT TTAAATTTGC AAGACATGGT TACACTTCTA GGAGGACATA TGATGGGCCG AACTCGTTGT AGCAACATCT  TAGACCGACT ATACGACTTC AACAAAACAG GGAAACCCGA CCCGACAATG GAACCAACCA CATTAAGCAT CTTACAAAAG CAATGTCCCA AGAAGGTGAA GTTGGGCCAG CCCAATCCTC  TTATAAACTT GAACCCGGAT AACCCAACAC ACAAGTTTAC CAATTCTTAC TACTCAAGAG TGTTGGCAAG TAAATCTGTT CTAGGGGTTG ACCAACAACT ATTGTATGGT ACTGACACAC  ATGATCTAAC CGATGAATAT GCTAATGGGC TTGAAGACTT TAAGGGTGGA TTCGCTTACT CGATGAGCCG GATGGGGGGA CTCAAGGTTC TTACCGGAAA GAACGGTGAA ATACGAAAGA  ATTGTCATGT TGTTAACAAG TAGATCGACC TATACTTCAT GTCGACAATG AAACTAGCTA CATATATACA AATATATGTG TGTATATGAC ATAAAAGTGA GATAAATATG ATCATTTTGT  ATTATTGATC ATAAGTGAAT TCATGTTCAT GTACTATGTT TTCGTTAAAT CCTTGGATTA CTGAATATTA ATTTTTCAAA ACATATTTGT ATGATATAAA CTCCTTTTAA GTGTGTCAAT 
GTTTTCTAGA AGAATTA 

Retrieve as FASTA