Entry information : HaPrx126 (HanXRQChr17g0561141)
Entry ID 13587
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx126 (HanXRQChr17g0561141)
Name (synonym) HaPrx126 (HanXRQChr17g0561141)
Class Class III peroxidase     [Orthogroup: Prx094]*
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx126
start..stop
S start..stop
HaPrx01_QIR8 427 5e-152 1..297 1..305
HaPrx[P]128 423 3e-150 1..294 1..322
HaPrx01 422 6e-150 1..297 1..305
HaPrx127 422 6e-150 1..297 1..305
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 157295640..157295861 222 N° 2 157295963..157296142 180 N° 3 157296251..157296392 142 N° 4 157298504..157298871 368
join(157295640..157295861,157295963..157296142,157296251..157296392,157298504..1 57298871)


exon

Literature and cross-references HaPrx126 (HanXRQChr17g0561141)
DNA ref. HanXRQ genome:   HanXRQChr17 (157295640..157298871)
Protein sequence: HaPrx126 (HanXRQChr17g0561141)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   303
PWM (Da):   %s   32914.54 Transmb domain:   %s   o10-32i
PI (pH):   %s   7.24
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSYKYMETILIPAFILLLSLNYVMPCNLTVNFYDKTCPKALASIKRSVWAAVASNPRNAALLVRLHFHDCFVQGCDASLLLEGAGSEKASPANDGVLGYEVIDAVKAAVERVCPGVVSCADILAVAARDATVAGSIMDSKTWKKRSEAITDLPRGNMNLNQLIDNFRRKGLNAREMVALSGSHTIGQARCVRFRGRIYNSSLNIDAAFNSSLTESCPPTAPNGDSNLQPLDLVTPNRFDNNYFKNLVSNKGLLISDQVLFNRDSTDSIVTEYVNNPSTFDSDFAAAMIKMGEMMSLLVLMEL

Retrieve as FASTA  
Remarks GGP anad GGRD are missing
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAGTTACAAGTATATGGAAACTATTTTGATTCCTGCATTTATTTTACTTCTATCATTGAACTACGTCATGCCATGCAACTTGACAGTCAATTTTTACGATAAAACATGCCCTAAA
GCACTTGCAAGTATCAAACGTTCTGTTTGGGCCGCGGTGGCTAGTAATCCTCGGAATGCAGCCTTGCTCGTTCGCCTTCACTTTCATGATTGTTTCGTTCAG
GTTATGATTCATCTCTTT
AATCCATGGTTCTTTTTTTTTTTTGGTGATTAGACATAAGAACAAGCAGTTTTAAATTATTAATCTGGTTAATAATTCTTCAGGGTTGTGATGCATCTCTTTTGCTAGAAGGTGCTGGTA
GTGAGAAGGCATCACCAGCCAATGATGGTGTGTTGGGCTATGAAGTTATAGATGCTGTTAAAGCTGCAGTCGAGCGGGTATGTCCTGGAGTTGTTTCGTGTGCGGATATACTTGCGGTTG
CAGCTCGAGATGCTACCGTGGCG
GTAAGGACATAACTAAATTAGTTACATGTAAAATATGGGTTCATAAAACCTGTAACTATTTACTGGTAAATTAAGGTAGCCAGTGTATGACTATATT
TTGTAGGTGAGGGGTCCATCATGGACAGTAAGACTTGGAAGAAGAGATCTGAAGCCATTACTGATCTTCCAAGAGGGAATATGAATTTAAATCAACTCATTGATAACTTTCGTCGTAAGG
GACTCAACGCAAGAGAAATGGTAGCCTTATCAG
GTTTGATATGCTTCTTTGTTCTTCCTTTGTATTATTATATACATGCAAAATCACAATAAGGATAAGTGGCATAGAATATACCCCAAG
GAACTCCATTGCACTACCTTATACCTTAGCGTACCTTATACCTTAGCGTCACGTAAATAGAGGTATTATTCTGTTGTTTTAATAACACCAAACCAATGGAATAAGCCTCTCAATCATTAT
TAAATCATATATATATTTTTTAAATTTGATTTTGTATAACATTTGAACTAAAAATAAAATAAAATAAAAAAATAAAGTAAAAAATAAACTACCAACTTAAAAATAATATTAACATAATTT
CAAAAAAAAAAAAAAAACCAAAAAAAAAAGAAAACAATACATTGTTGGTTACAATAAAAACGACAAGATGGTTTCTCAAAATTCTTCAAGTCGCGACGTTAACAAACTGAATATTGTGAT
GTTTTTGGAACTCGCTATGGGTTGCGGCAATCGCTTCATCTTCAAGTAAACCCTCCTTATGGTTCAACCCATGGACATAGCAAATCTCAAATTTTGTACACTTTATTCGTAGAAGCAAAA
ACCTTCCTAATATTGAATTGATATTATGACGGTTTTCACCCACATGTTGATGTAATGTAGACTTAACCCGGTTCCAGGATTGATGTGAATATGAAGTCATCCCTAGCTCAACAACTTCCA
CCCAACTCGTGCTTAAAGCGATATCATCTTCTTGGGTCCAACATCGCGCCATTTGAGATTAGAGATTTTGAGAGCATAGAAATTGAGTAAAAATATAAATGTGTGTGTTTATATGGAAAA
GTAAAAGAATTTGATTTTTTTTTCTTTCTAAAATGACCGTTGATCAGCAGTCACTTTTCATAATGGCCTACCAAACTCGCCCGGTTTCCGCTAGTTATTGTGGTCACGGTTGACCAATAA
TGCCCCTCGAATGGTGCCACAATGATAGGGGAGGGGGCTATCGTGTGTTTTGCCGCTTATGTGGATGGGGCACCGCCCATACCACTAAGTCTAACAACCATGTTAACCAAGAATATTAAC
AAAAGATTTACTAACAACCATGTTAACCAACAATATTAACAAAAGATTTATAAGAAAATACACCCATTGATAAAATGGCAAGTGTCCAAAAAGTTTAAGCCACTGCAATATCATAAAGAA
TAAATTAAGGGAAAATCACAAACATTTACATCCATCCGAGATAAAAAGCGAAAATAAACATTGGAAACGGTTATGCATGGGCCTCATCCTTTTCCAAGTTTTGTGAGACCCACCTTGAGA
ACCAATAAAAATAGATATTTAGCAGATGAAAACACTGAAACCAGCTATATAGAGACTTCACATGGGGAGGAAGTGTCTAAACCGAATTGGCTAGGACGAGAAGCAACGGTGGTGTAGCAT
TTTCCTGTTTCTTTAGGACGAGAAGAAAAGGTCGTGTAGCATTTTCCTGTTTTTTTCTCTCACGATTTTAAACAGGCATAATTTTTTCAAACGACAATGTTCTTTAAAAAAATCTACATC
AAATTAAAAAGAATAAAATATTTTTTGATTTGGTGTAATTTAAAACGACAATGTTCTTTAAAAAAATCTACATCAAATTAAAAAGAATAAAATACTTTTTGATTTGGTGTAATTTAAAAA
TAGTATATGATGTAAAAAAGTTATACTCGTTTAAAAAGATGATCGTTTTTCCTTTATGTGAAGTCTCTACACAAAAACTTCCAGCGTTTAATTTAGCTTTTATGTCCCTTAATTAAATGT
GTATATTTGTGATTTTCCATTCAGTTAAACTAAAAAGCAATCTTGCCATATTGACATAGGATCATTGGAATTCTTGTGCAAAAGTATAATTTAAAAAATCACATATTTTTGTGCCCACTA
ATTAAAAGAACGTATAAACAAATAAACGAATTACATTCTTTTAAATAAAATAATATTTTACATTATGTTCAATTAAAGAATAAAATTATTAAAGTTTCAATTAAACAAACATTAAAATTA
AAAAAAAATTAAATTTATAAATATACAACATAAAACTATTGTAATTTAGTTTTTCATATATATTCAATTGCTGTTAAACCTGTACAATAATTATTTTCTTGCAGGGTCTCACACAATCGG
GCAGGCCAGATGTGTTAGGTTTAGGGGAAGGATATATAACAGTTCTTTAAATATAGATGCTGCTTTTAATAGCTCCCTTACTGAAAGTTGCCCACCGACTGCACCTAATGGCGATAGTAA
CCTACAACCACTTGATTTAGTGACACCAAATAGATTCGACAACAACTACTTCAAGAATCTAGTCAGTAACAAGGGTCTTCTTATATCAGACCAGGTGCTCTTTAACAGAGACTCAACTGA
TAGCATCGTGACTGAGTATGTCAACAATCCTTCCACGTTTGATTCTGATTTTGCTGCAGCCATGATAAAGATGGGTGAAATGATGTCCTTACTGGTACTAATGGAATTATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAGTTACAAGTATATGGAAACTATTTTGATTCCTGCATTTATTTTACTTCTATCATTGAACTACGTCATGCCATGCAACTTGACAGTCAATTTTTACGATAAAACATGCCCTAAA
GCACTTGCAAGTATCAAACGTTCTGTTTGGGCCGCGGTGGCTAGTAATCCTCGGAATGCAGCCTTGCTCGTTCGCCTTCACTTTCATGATTGTTTCGTTCAG
GGTTGTGATGCATCTCTT
TTGCTAGAAGGTGCTGGTAGTGAGAAGGCATCACCAGCCAATGATGGTGTGTTGGGCTATGAAGTTATAGATGCTGTTAAAGCTGCAGTCGAGCGGGTATGTCCTGGAGTTGTTTCGTGT
GCGGATATACTTGCGGTTGCAGCTCGAGATGCTACCGTGGCG
GGGTCCATCATGGACAGTAAGACTTGGAAGAAGAGATCTGAAGCCATTACTGATCTTCCAAGAGGGAATATGAATTTA
AATCAACTCATTGATAACTTTCGTCGTAAGGGACTCAACGCAAGAGAAATGGTAGCCTTATCAG
GGTCTCACACAATCGGGCAGGCCAGATGTGTTAGGTTTAGGGGAAGGATATATAAC
AGTTCTTTAAATATAGATGCTGCTTTTAATAGCTCCCTTACTGAAAGTTGCCCACCGACTGCACCTAATGGCGATAGTAACCTACAACCACTTGATTTAGTGACACCAAATAGATTCGAC
AACAACTACTTCAAGAATCTAGTCAGTAACAAGGGTCTTCTTATATCAGACCAGGTGCTCTTTAACAGAGACTCAACTGATAGCATCGTGACTGAGTATGTCAACAATCCTTCCACGTTT
GATTCTGATTTTGCTGCAGCCATGATAAAGATGGGTGAAATGATGTCCTTACTGGTACTAATGGAATTATAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCTTTTTTCT CTCTAATAAT ATGGGCAGTT ACAAGTATAT GGAAACTATT TTGATTCCTG CATTTATTTT ACTTCTATCA TTGAACTACG TCATGCCATG CAACTTGACA GTCAATTTTT  ACGATAAAAC ATGCCCTAAA GCACTTGCAA GTATCAAACG TTCTGTTTGG GCCGCGGTGG CTAGTAATCC TCGGAATGCA GCCTTGCTCG TTCGCCTTCA CTTTCATGAT TGTTTCGTTC  AGGGTTGTGA TGCATCTCTT TTGCTAGAAG GTGCTGGTAG TGAGAAGGCA TCACCAGCCA ATGATGGTGT GTTGGGCTAT GAAGTTATAG ATGCTGTTAA AGCTGCAGTC GAGCGGGTAT  GTCCTGGAGT TGTTTCGTGT GCGGATATAC TTGCGGTTGC AGCTCGAGAT GCTACCGTGG CGGGGTCCAT CATGGACAGT AAGACTTGGA AGAAGAGATC TGAAGCCATT ACTGATCTTC  CAAGAGGGAA TATGAATTTA AATCAACTCA TTGATAACTT TCGTCGTAAG GGACTCAACG CAAGAGAAAT GGTAGCCTTA TCAGGGTCTC ACACAATCGG GCAGGCCAGA TGTGTTAGGT  TTAGGGGAAG GATATATAAC AGTTCTTTAA ATATAGATGC TGCTTTTAAT AGCTCCCTTA CTGAAAGTTG CCCACCGACT GCACCTAATG GCGATAGTAA CCTACAACCA CTTGATTTAG  TGACACCAAA TAGATTCGAC AACAACTACT TCAAGAATCT AGTCAGTAAC AAGGGTCTTC TTATATCAGA CCAGGTGCTC TTTAACAGAG ACTCAACTGA TAGCATCGTG ACTGAGTATG  TCAACAATCC TTCCACGTTT GATTCTGATT TTGCTGCAGC CATGATAAAG ATGGGTGAAA TGATGTCCTT ACTGGTACTA ATGGAATTAT AAGGACTCGT TGCACTGCTG CAAGTTAAGA  AAAAGGAGAT GTAAATTTAA TATAAATATA TAATGTATCA TTGTTGGCTT GTTGAATGTT ATGCAGTCAC AAACAAGTAT TCTGCATGCT TTGTTGATCA CATACAATAA ATAAAAGTCT 
CCTTAATTTC AACCGGGTAA TTTTTTCTTT TTAAATTTCA TTGACAC 

Retrieve as FASTA