Entry information : HaPrx127 (HanXRQChr17g0565151)
Entry ID 13588
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx127 (HanXRQChr17g0565151)
Name (synonym) HaPrx127 (HanXRQChr17g0565151)
Class Class III peroxidase    [Orthogroup: Prx146]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx127
start..stop
S start..stop
HaPrx01 530 0 1..318 1..318
HargPrx20 529 0 1..318 1..318
HaPrx01_QIR8 526 0 1..318 1..318
HargPrx19 490 1e-177 1..246 1..246
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 182796960..182797187 228 N° 2 182797287..182797466 180 N° 3 182797637..182797802 166 N° 4 182798153..182798604 452
join(182796960..182797187,182797287..182797466,182797637..182797802,182798153..1 82798604)


exon

Literature and cross-references HaPrx127 (HanXRQChr17g0565151)
DNA ref. HanXRQ genome:   HanXRQChr17 (182796960..182798604)
Protein sequence: HaPrx127 (HanXRQChr17g0565151)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (312)
PWM (Da):   %s   36356.78 (33056.2) Transmb domain:   %s   i7-26o
PI (pH):   %s   4.43 (4.35) Peptide Signal:   %s   cut: 30 range:30-341
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGYSMSIGTIMFPLFILLIFANYFMPCKAQLSTTFYDTTCPNAITTIQTSVNASVANNTRNAAFLIRLLFHDCFVQGCDASLLLGGADSERESPANNGVFGYDVIDAAKAAVESVCPGVVSCADILAVAARDASVAVNGPSWTVRLGRRDSTNSNASQAATDLPRGNFNLTELIANFDLKGFNAREMVALSGSHTIGQARCSRFRGRIYNSPLNIDAAFNSSLSEICPPTGGDENLQPLDLVTPNTFDNSYFRNLVASRGLLISDQVLFNGDSADSIVTEYVNNPATFESDFAAAMVKMSEIEVLTGTSGIIRTVCNSTVVNGPVMLNSNGQNGQIMYQES

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTATTCTATGTCTATTGGAACTATAATGTTTCCTCTATTCATTTTACTTATATTCGCGAACTACTTCATGCCATGCAAAGCTCAATTGTCAACCACCTTCTACGATACCACATGC
CCTAATGCAATTACAACCATTCAAACTTCTGTCAATGCTTCGGTGGCTAATAATACTCGCAATGCAGCCTTTCTCATTCGCCTTCTATTTCATGATTGTTTCGTTCAG
GTTATATATGAT
CTTTTGTTCCATTGTGCTTCTTTTTGGTAATTTGTAATAAGAACACATTCAGTTTATAGTTTTTTAATCTGGTTAATAATTTTGTAGGGTTGTGATGCATCTCTTTTGCTAGGAGGTGCT
GATAGTGAGAGGGAATCACCAGCGAATAATGGTGTGTTCGGCTATGATGTTATAGATGCTGCTAAAGCTGCAGTCGAGAGCGTTTGTCCTGGAGTTGTATCGTGTGCTGATATACTCGCG
GTTGCTGCTCGTGATGCTTCGGTAGCG
GTAAGAACAAAACTGCATCAGTTACATGTAATATATAGGTTCATAAAATATATTTTTTTGAACGACAAATTTGGATCTCTGACGGACCGCTGG
AGTATCATCATGCCACCAGCGGAACCACCCAATCACAAAATATATAATTAAGGTAGTTTATTTTAAACACTATGTAGGTGAATGGTCCATCCTGGACAGTAAGACTTGGAAGAAGAGATT
CTACAAATTCAAACGCGAGTCAAGCCGCAACTGATCTTCCAAGAGGGAACTTTAATCTAACTGAACTCATTGCAAACTTTGATCTTAAGGGATTCAATGCTAGAGAAATGGTCGCCTTAT
CAG
GTTAGATCTGCTTCAGTGTGTTTCCTTGATATTACATGACAGTTTTTTTTTTTTTTTAATCTTCGTTAAATGTTACTTGGAACACTACTAAAATGAAGCAAACACGATTAAAAATCG
CGACCCATAGAAAGAGTCGCAAATGTAACGACCAAATTAATTAGTGATCATAAAGAACTAGCTATTGAGAATGATTATGCCCAAAACGGCTGCAAATTATTTAAAAATTAAATTCGATCG
AAAAAGGTAGGAAACTTTATTTATAGAAACTAAGAAAAAAATTCCTTCTCAAATTCTACAAGCTTCTATGGAAGTATATAAGGCATTTGTGACCGAAAATTATCATCTTGCAGGGTCTCA
CACAATTGGGCAAGCCAGATGTAGTAGGTTTAGGGGAAGGATATACAACAGTCCTCTAAATATAGATGCTGCTTTTAACAGCTCCCTTAGTGAAATCTGCCCACCAACCGGAGGCGATGA
GAACTTACAACCACTTGATTTAGTGACCCCAAATACATTCGACAACAGCTACTTCAGGAATCTTGTTGCTAGTAGGGGTCTTCTTATATCAGACCAAGTACTCTTTAATGGAGACTCAGC
TGATAGCATAGTGACCGAGTACGTCAACAATCCTGCAACATTTGAGTCTGATTTTGCTGCAGCCATGGTTAAGATGAGTGAAATTGAAGTCCTTACCGGTACCAGTGGGATTATAAGGAC
TGTTTGCAATAGTACTGTTGTGAATGGGCCTGTGATGTTGAACTCAAATGGGCAGAATGGGCAGATCATGTATCAAGAAAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTATTCTATGTCTATTGGAACTATAATGTTTCCTCTATTCATTTTACTTATATTCGCGAACTACTTCATGCCATGCAAAGCTCAATTGTCAACCACCTTCTACGATACCACATGC
CCTAATGCAATTACAACCATTCAAACTTCTGTCAATGCTTCGGTGGCTAATAATACTCGCAATGCAGCCTTTCTCATTCGCCTTCTATTTCATGATTGTTTCGTTCAG
GGTTGTGATGCA
TCTCTTTTGCTAGGAGGTGCTGATAGTGAGAGGGAATCACCAGCGAATAATGGTGTGTTCGGCTATGATGTTATAGATGCTGCTAAAGCTGCAGTCGAGAGCGTTTGTCCTGGAGTTGTA
TCGTGTGCTGATATACTCGCGGTTGCTGCTCGTGATGCTTCGGTAGCG
GTGAATGGTCCATCCTGGACAGTAAGACTTGGAAGAAGAGATTCTACAAATTCAAACGCGAGTCAAGCCGCA
ACTGATCTTCCAAGAGGGAACTTTAATCTAACTGAACTCATTGCAAACTTTGATCTTAAGGGATTCAATGCTAGAGAAATGGTCGCCTTATCAG
GGTCTCACACAATTGGGCAAGCCAGA
TGTAGTAGGTTTAGGGGAAGGATATACAACAGTCCTCTAAATATAGATGCTGCTTTTAACAGCTCCCTTAGTGAAATCTGCCCACCAACCGGAGGCGATGAGAACTTACAACCACTTGAT
TTAGTGACCCCAAATACATTCGACAACAGCTACTTCAGGAATCTTGTTGCTAGTAGGGGTCTTCTTATATCAGACCAAGTACTCTTTAATGGAGACTCAGCTGATAGCATAGTGACCGAG
TACGTCAACAATCCTGCAACATTTGAGTCTGATTTTGCTGCAGCCATGGTTAAGATGAGTGAAATTGAAGTCCTTACCGGTACCAGTGGGATTATAAGGACTGTTTGCAATAGTACTGTT
GTGAATGGGCCTGTGATGTTGAACTCAAATGGGCAGAATGGGCAGATCATGTATCAAGAAAGTTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTACAT GGCTCCTCCT ACTTAAGCTA CCATTATCTT TAATAAAACA AGAGGCTAAA GCTTCTTTTT CTTTACTAAT ATGGGGTATT CTATGTCTAT TGGAACTATA ATGTTTCCTC  TATTCATTTT ACTTATATTC GCGAACTACT TCATGCCATG CAAAGCTCAA TTGTCAACCA CCTTCTACGA TACCACATGC CCTAATGCAA TTACAACCAT TCAAACTTCT GTCAATGCTT  CGGTGGCTAA TAATACTCGC AATGCAGCCT TTCTCATTCG CCTTCTATTT CATGATTGTT TCGTTCAGGG TTGTGATGCA TCTCTTTTGC TAGGAGGTGC TGATAGTGAG AGGGAATCAC  CAGCGAATAA TGGTGTGTTC GGCTATGATG TTATAGATGC TGCTAAAGCT GCAGTCGAGA GCGTTTGTCC TGGAGTTGTA TCGTGTGCTG ATATACTCGC GGTTGCTGCT CGTGATGCTT  CGGTAGCGGT GAATGGTCCA TCCTGGACAG TAAGACTTGG AAGAAGAGAT TCTACAAATT CAAACGCGAG TCAAGCCGCA ACTGATCTTC CAAGAGGGAA CTTTAATCTA ACTGAACTCA  TTGCAAACTT TGATCTTAAG GGATTCAATG CTAGAGAAAT GGTCGCCTTA TCAGGGTCTC ACACAATTGG GCAAGCCAGA TGTAGTAGGT TTAGGGGAAG GATATACAAC AGTCCTCTAA  ATATAGATGC TGCTTTTAAC AGCTCCCTTA GTGAAATCTG CCCACCAACC GGAGGCGATG AGAACTTACA ACCACTTGAT TTAGTGACCC CAAATACATT CGACAACAGC TACTTCAGGA  ATCTTGTTGC TAGTAGGGGT CTTCTTATAT CAGACCAAGT ACTCTTTAAT GGAGACTCAG CTGATAGCAT AGTGACCGAG TACGTCAACA ATCCTGCAAC ATTTGAGTCT GATTTTGCTG  CAGCCATGGT TAAGATGAGT GAAATTGAAG TCCTTACCGG TACCAGTGGG ATTATAAGGA CTGTTTGCAA TAGTACTGTT GTGAATGGGC CTGTGATGTT GAACTCAAAT GGGCAGAATG  GGCAGATCAT GTATCAAGAA AGTTGAGGGG TTTTGTGATA GGGTCCACGT CAGCATGCAA ATAACCGATT GGCAGAAAAA ATGTGTGTTT AAAAAAAAAT AAAATTTGAA TAACTGATTG  GATCCGTTTT TTTCTTATCT TATGTATTCT ATATGTATTC TCTCATCTTC TTTTCTTGTT GAATATTGAT AAAGTTGTCT AGTTCTTTTC TCAATTGATT TTATTAATGT GAACCCAACT  GATCGAACCA CTTCAACTGC CAGTTAAGAA AAAGGAGATG TAACTTGTAG TCTTGTAACT TGTGAGGTTG ATAATATATC ACTGTTGCAT ATATGTTACG CAGTCGTCAC AATCAACTAT 
TTTGCATGCT TTGCTGTTCA CGTGTAATAA TTAATAATAT AATATCTAGA ATGAC 

Retrieve as FASTA