Entry information : HaPrx[P]128(HanXRQChr17g0565581 / HanXRQChr17g0565591)
Entry ID 13589
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-09 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2022-05-19 (Christophe Dunand)
Peroxidase information: HaPrx[P]128(HanXRQChr17g0565581 / HanXRQChr17g0565591)
Name HaPrx[P]128(HanXRQChr17g0565581 / HanXRQChr17g0565591)
Class Class III peroxidase     [Orthogroup: Prx094]*
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx[P]128
start..stop
S start..stop
HaPrx126 448 6e-160 1..322 1..294
HaPrx01_QIR8 435 1e-154 1..340 1..320
HargPrx20 431 5e-153 1..340 1..320
HaPrx01 431 6e-153 1..340 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 185544658..185544879 222 N° 2 185544956..185545135 180 N° 3 185545236..185545388 153 N° 4 185547592..185547710 119
N° 5 185547991..185548339 349  
join(185544658..185544879,185544956..185545135,185545236..185545388,185547592..1 85547710,185547991..185548339)


exon

Literature and cross-references HaPrx[P]128(HanXRQChr17g0565581 / HanXRQChr17g0565591)
DNA ref. HanXRQ genome:   HanXRQChr17 (185544658..185548339)
Protein sequence: HaPrx[P]128(HanXRQChr17g0565581 / HanXRQChr17g0565591)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340
PWM (Da):   %s   37019.44  
PI (pH):   %s   5.19
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGNYKYSETILIPIFILLLSLNYVLPCNLTTNFYDKTCPKALATIKRSVQAAVSTNPRNAASLVRLHFHDCFVQGCDASILLEGMNSEKASQANNGVLGYNLIDDAKAAVESVCPGVVSCADILALAARDATVAVWGPSWPVRLGRRDSTTFNADEAARDLPRGNFNLNQLIDNFRRKGLNAREMGLTQSGRRDVLHLEAGSEAEDSRCSGVHPPTPIFRLEVYKIYNSSLNIDAAFNSSLSERCPQTAPNGDSNLQPLDLMTPNRFDNNYFRNLVSSRGLLISDQVLFNGDSTDSIVTEYVNNPSTFDSDFAAAMIKMGEIDVLTGDNGIIRTRCTAAS

Retrieve as FASTA  
Remarks Pseudogene from genomic (VALS is missing). LSGSHTLGQARCVRFRGRI cand be found in another frame.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAATTATAAGTATAGTGAAACCATCTTGATTCCTATATTTATTTTACTTCTATCATTGAACTACGTCCTGCCATGCAACTTGACAACCAATTTTTACGATAAAACATGCCCTAAA
GCACTTGCAACCATCAAACGTTCTGTTCAAGCTGCGGTGTCTACTAATCCTCGGAATGCAGCCTCGCTAGTCCGCCTTCATTTTCACGATTGTTTCGTTCAG
GTAATATTGCATTTCTTT
ATTCAATGTTGCTTCTTTTTAGTTAGAACATGCAATTTTGATCTTGTTAATTGTTCAGGGTTGTGATGCATCTATTCTGCTAGAAGGTATGAATAGCGAGAAGGCATCACAAGCGAATAA
TGGTGTGTTGGGCTATAATCTTATAGATGATGCAAAAGCTGCAGTCGAGAGTGTATGTCCTGGAGTTGTTTCGTGTGCAGATATACTTGCGCTTGCAGCTCGAGATGCTACCGTGGCG
GT
AAAGACAAATAAATAAGTTGCATGTAAATATAGGTTCATAAAATCTATAACTATATACGGGTAAATTAAGGTAGCTAGTGTATGAATATATTGTGCAGGTGTGGGGTCCGTCATGGCCAG
TAAGACTTGGAAGAAGAGATTCTACAACTTTTAACGCAGATGAAGCCGCCAGGGATCTTCCAAGAGGGAATTTTAATTTAAATCAACTCATTGATAACTTCCGTCGTAAGGGACTCAACG
CAAGAGAAATG
GTCACAATAATTCTATAAAGGCAAAGTCACAATAACAATCATGTTAGGCTATGTGTTATGATTTGCTCTCTTTTTACGCACTCTTTCATGTGATTTTTTTTATTGTGAC
ATGGGGTGTGCCGGTGTGGTGAAAGTTTTATAATTTTGTAAACAATTTGTCGTAGACTCTTCGGAGAAAGTTTTATAATTTTGTAAGAAACTAGTTGATGCCCCGCCCGCGTTGTATGGC
GATAGCCGAATAATTCTCAATCAATTAAAAAAGATTACTATAATTTTGCTAGAAAAAAAAAAACAAAAACGATGATAAGACCATAATTTTGGGCTCAGGACAAAATTGTAATTTTTCATG
ACTGCTGAGCCAGTGTTAGGGAGCTCCTTGACACGGGAAAAAATTAAATCGAGTCAACTAATTAAAACAAAAAGCTTTTATAGTTTTGCTAAAAAAACTAAAACGATGGGAAAAACGTAA
TTTTTAACTGAGGGCGAATCATGATTTTAATTCAGGAATAAAATCGTAAATTAAATGAACCGACAGGGGAGTGCCAGGCAGCTGCCGGCATGACTGTAATTTTACACTGGGGGCAAAATT
GTAATATCACCAGCAAACAAACAAAAATGATGGACAAAATGTAAATTTAAATATCGTAACTTGGCTATGAGAAAAAAAAAAACTAGTGGCAAAACTATAAATTTATACGGGCCAAAATCG
TAATTTTGAACCGAGGGCAAATTTGGAATTTTTAGCTAGGAGCAAAAGCGTAAACTTATTTTTAAGTGGGGGTAAAAACATAATTTTCTTGGAATTTTTAGTTGGGAGCAAAAGCGTAAA
CTTATTTTTAAGTGGGGGTAAAAACATAATTTTAAACTGACGGGAAAATCGTAAGTTTAAAGGGAAAAAACTAACGGCAAAACTGTAAATTGAACGGGGCAAAATCGTAATTTTGAACCG
GGGGCAAAATTGAAATATTTAGCTAGGAGCAAAAGCGTAAATTTATTTTTAAGAGGGGGCAAAAACATAATTTTGAACTGATGGCAAAATCGTAATTTTAAAACGGGATAAAATTGTAAA
TTTGTTAGGCCAATAGGGGAGTGTCAGGCAGCTGTCTGACACTATTGTCTCTGCCGCCCATCTAGGCCAATAGACATCAACCACTATTACTCCTCATGGGGTTTGTAGATATTGAATGTA
GATATTGAATTTGTCACAAGAAAGTTTTATAATTTGTTGGAATTTTGTCGCAAAATAAAAAAAATTATGGATAATTTTTTTAATAACGATGTTAATTTAAAAAAATAAAATATTATAAAA
TAAAATACAAAAAAGGCAAAATTGTCGCAGAATCGTCTGAATTTTGCGATGAGAGCACTTTGTTAGTATTTTGTAGCAAATTTTCCGACGAGAGTTTTTGTCGTATTTTTGTAGCTAATC
TGGTTAGCGACAAGTTTATTTCGCAAGGATTTTTTTTTGTAGCTAATTTGTGGGTAAGACCAATTTCAGACAGATTTACTACAAATTCGATTGTCACAAACCGAACAGTTTTCTAGTAGT
GACAAGTAGTACTCCACACTCATTCTTGTGACTTCTCTTACGGCGAGCCCTCTCATGTCTGATCGGACTGCCACCTGACCTGGGGTGAGAATATAACATGTTATATGGTCTTAACAAACA
ATATTAATAAAAGTATTATAGGAAAGTATACCCAATAATACTTAAATGACAAGTGTCCATGGTAGCGAAGTATAATTTAAAAATTCACATATATTTGGCCATGGTAGCGAAGGATCATCG
GAAATCTTGCGGCAAAGTATAATTTAAAAATTGACATATATTTGCGCACACTAACTAAAAAAACTTTAAACACATATAATAATTAAAAGTCTTTTTTTCTTTAATGGTCTTTTACATTAT
GTGCCCAATTCAGAACAAAAAAAAAATAAATAAATAAATAAAATCCTACCCGGCGACACTGTTTATTAAAACTTTTATTTTTTAAAAACATGAAATTATTAAAATATAAAAAATTAAAAC
TATTAAAACTTAATTTTTTAAATACAAAAACTAAAATATATTATAATTAATTTCTATAAATATATTTAAAAACTTGTTTTATTAAATATCGAAAAACTCAATTTTTCAATATTTGAGAAC
TTAAAGGTGAGTAGAATTGCTAGTTAAACATGTGCGATAACTATTTTCTTGCAGGGTCTCACACAATCGGGCAGGCGAGATGTGTTACATTTAGAGGCAGGATCAGAGGCGGAGGATAGT
AGGTGCTCGGGGGTGCACCCGCCCACCCCAATATTTCGGTTAGAAGTGTACAA
GTTCCGATTTTTCGTCCGAAAATTTTAAAATTATATAGGATCGCCCCCCAGATTATTTTTCATAAAT
TGCATATTCTAAATATTTATAAACTTTGTATATAAATGATGGGTAGTTTGGTAAATATACACTTTGTTTTATTTGGAACTATTATTATTTGACCCAATTTGAATCAAATAGCCAACCCGA
CCCGAACCTAAACATAACGATAGGAAAAAAGTTTTTTGGGTCCCATTACTTACGCCCCCTCGAAACTTTTGGTCAAGCTCCGCCACTGGGCAGGATATACAACAGTTCTTTAAATATAGA
TGCTGCTTTCAATAGTTCCCTTAGTGAACGCTGCCCACAGACTGCACCTAATGGCGATAGTAACCTACAACCACTTGATTTAATGACACCAAATAGATTCGACAACAACTACTTCAGGAA
TCTAGTTAGTAGTAGGGGTCTTCTTATATCAGACCAGGTGCTCTTTAATGGAGACTCAACTGATAGCATCGTGACCGAGTACGTTAACAATCCTTCTACGTTTGATTCGGATTTTGCTGC
AGCCATGATTAAGATGGGTGAAATTGATGTCCTTACTGGTGATAATGGAATTATAAGGACTCGTTGCACTGCTGCAAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAATTATAAGTATAGTGAAACCATCTTGATTCCTATATTTATTTTACTTCTATCATTGAACTACGTCCTGCCATGCAACTTGACAACCAATTTTTACGATAAAACATGCCCTAAA
GCACTTGCAACCATCAAACGTTCTGTTCAAGCTGCGGTGTCTACTAATCCTCGGAATGCAGCCTCGCTAGTCCGCCTTCATTTTCACGATTGTTTCGTTCAG
GGTTGTGATGCATCTATT
CTGCTAGAAGGTATGAATAGCGAGAAGGCATCACAAGCGAATAATGGTGTGTTGGGCTATAATCTTATAGATGATGCAAAAGCTGCAGTCGAGAGTGTATGTCCTGGAGTTGTTTCGTGT
GCAGATATACTTGCGCTTGCAGCTCGAGATGCTACCGTGGCG
GTGTGGGGTCCGTCATGGCCAGTAAGACTTGGAAGAAGAGATTCTACAACTTTTAACGCAGATGAAGCCGCCAGGGAT
CTTCCAAGAGGGAATTTTAATTTAAATCAACTCATTGATAACTTCCGTCGTAAGGGACTCAACGCAAGAGAAATG
GGTCTCACACAATCGGGCAGGCGAGATGTGTTACATTTAGAGGCA
GGATCAGAGGCGGAGGATAGTAGGTGCTCGGGGGTGCACCCGCCCACCCCAATATTTCGGTTAGAAGTGTACAA
GATATACAACAGTTCTTTAAATATAGATGCTGCTTTCAATAGTTCC
CTTAGTGAACGCTGCCCACAGACTGCACCTAATGGCGATAGTAACCTACAACCACTTGATTTAATGACACCAAATAGATTCGACAACAACTACTTCAGGAATCTAGTTAGTAGTAGGGGT
CTTCTTATATCAGACCAGGTGCTCTTTAATGGAGACTCAACTGATAGCATCGTGACCGAGTACGTTAACAATCCTTCTACGTTTGATTCGGATTTTGCTGCAGCCATGATTAAGATGGGT
GAAATTGATGTCCTTACTGGTGATAATGGAATTATAAGGACTCGTTGCACTGCTGCAAGTTAA

Retrieve as FASTA