Entry information : HaPrx42 ( HanXRQChr02g0053951)
Entry ID 13596
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx42 ( HanXRQChr02g0053951)
Name (synonym) HaPrx42 ( HanXRQChr02g0053951)
Class Class III peroxidase    [Orthogroup: Prx032]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx42
start..stop
S start..stop
HaPrx24 540 0 1..334 1..333
HaPrx43 493 2e-177 1..325 3..329
HaPrx102 486 1e-174 1..325 3..324
LsaPrx42 456 2e-163 1..287 1..287
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 159745048..159745272 225 N° 2 159745840..159746019 180 N° 3 159746123..159746285 163 N° 4 159747769..159748205 437
join(159745048..159745272,159745840..159746019,159746123..159746285,159747769..1 59748205)


exon

Literature and cross-references HaPrx42 ( HanXRQChr02g0053951)
DNA ref. HanXRQ genome:   HanXRQChr02 (159745048..159748205)
Protein sequence: HaPrx42 ( HanXRQChr02g0053951)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (308)
PWM (Da):   %s   35943.04 (33192.6) Transmb domain:   %s   i7-26o
PI (pH):   %s   7.93 (7.68) Peptide Signal:   %s   cut: 27 range:27-334
Sequence 375
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANSKAVAFIAAIMFIILNLTGHCYGDLQFGFYNGKCQSSDVEDIVRRTVVAKFFSDKTIAPALIRMQFHDCFVNGCDASILLDGNNSEKTASPNLSVRGYDVIDDAKAAVERVCPGVVSCADIIVMATRDVISLSGGGRYNVQTGRRDGTVSLAQNTASLPSPSTSVSSAIQAFASKGLNATDMIYLLGGHTIGVTHCSFINDRLYNFKNTGKPDPNMDWELLTSLRRTCPQNAAVDRAINLDQNPFSSSVVDKSFYNQIMLRRGVFQIDQELAIDSLSKPTVAAIASSSDFTTKFGQAMVKLGAIQVLTGTQGEIRRSCRAVNGPTWPSLFN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAAACAGTAAAGCAGTTGCATTCATAGCAGCAATTATGTTCATCATCTTGAACCTAACCGGTCACTGCTATGGTGATCTCCAGTTTGGGTTCTACAATGGAAAGTGTCAAAGTTCAG
ACGTTGAAGATATTGTAAGAAGAACGGTTGTCGCTAAATTCTTTTCCGACAAAACGATCGCCCCAGCTCTCATTAGAATGCAGTTTCATGATTGCTTTGTGAAT
GTAAGTTAATATTCTT
CCATTTTCATGCATGCAACACCAACTATAACATGTATGCTATTTACATTCACCTATATACATTAAAAGTTTGTATATTGTGTTTCAGTAATTCAATATACAAGTTTGTATATAGAGAAAA
CCTAACTCTGATACCTACTAAACTGTTGTATATTGTATGTGTTTAAGTAAAACAATATACAATGTTATATGCAGAAAAAAAACCTAACCATGACACTATGTTGTATATATTATGTGTCTC
AATAAAACAATATACAAGGTAATATACAAAAAAACCAAGATACAAAACCCTAAGTGGCTTAACCCAAAGGTTAAACCCGAATGTAGAATATCTAATATACATGACAGAAAAAAATTATAT
GAATCTTATCATTTACTTATAAATATGTAAGTATAGTTAGTTAGATGTAAAATCACAAGGATTTTACATTCTTTGAGCATTAGCAAATTTCCTCAAGTCGCTTTGACAAAAAAATTGTAA
GAACACATATTTTTGTGGCGACGACCTCAGAAAATAAAAAAAAATTACTAACCTTTTGCATGTTTTTAAAGGGGTGTGATGCGTCAATTCTACTAGACGGAAACAACTCTGAGAAAACCG
CATCTCCAAATTTAAGCGTTAGGGGCTACGATGTGATTGATGATGCAAAAGCCGCGGTGGAGAGAGTGTGTCCAGGGGTGGTTTCTTGTGCTGACATTATCGTTATGGCTACAAGAGACG
TTATTTCATTG
GTAAACAATATTATATGTATTGAATTTTATAACTTATTAGATTCAGAACTTTATAATTATATTTAGTATGCATGTTTTAACTTTAAATATCATATTATTGTAGAGTGGT
GGAGGTAGATACAATGTCCAAACTGGAAGACGAGATGGGACAGTGTCTCTTGCGCAAAACACCGCAAGCCTCCCATCTCCTTCTACATCGGTATCAAGTGCAATTCAAGCTTTTGCTAGT
AAAGGACTAAATGCGACCGACATGATCTATCTTCTTG
GTAATTCATTAAACTATGACAATTTTAACACGCTTAAGATTTAAGTTAGATTTTATTTTAGACAGGCTAAACTAGAAATTAGA
AATATACCTAAAGGGGAAATTGGTAAAAGTCGCTCAAAACATATACTAAATTAGGTGTGTAACCAATCTTAGTCGAATCTACTATTGTGAAGGCTCAAGTTGAACTTGATTGAGCCTTCA
GTTTTAAACTTGTGCTTGACTTCACTACTAGAGAAGTGGAAATTTTCCTAAGAAAATTTACTATGGAAAAATATGAGGCGGAAATTCCTAAAAAAATGCGATAAACTTTGTACGCAAATA
ACCCTAATTTAGAGACAAAATTCCCACAAGATAGCGAAAAAAAAGAATCTTTGTAAATGTGTTGTGGCGTTCTCGTCCGACCAGCTTTCTACCAGTACTTAATTTAGCTCACTTATCTAT
ATTAGGTAAACTATGGTGATAAAGTGGTGTATTCTCCAATCAAATGGTTGTTGGTTCAAATCCTGGGCAGTGTGATGATTTTAACTATAGAAAAATAAAAAAAAATATTAGTCAAGGGCA
ATTTATATATCTACAAAATTTTCAAACGTAAAATAGCATAAGGATGATAAGGCTAGTGAGTCTCGGTATGGAGTTTTATAATACACTAACATGACTCACCCACGTAACTAGACTCGCGAG
AGTTCATTTCAAATATTTTCTAGTAAGTTCCAAAAAAAAAAAAAAAAAAAAAAAATTTTCTAGTAGGTACTAAGTAGCTTGCAAGATGACTTACCTTAATTACACCCCTATTGTAAAATT
AATACAAGATACGCATTAAATGTATTTTTAATGACAAAGTAACATACTTCTATGCCTGTACTTTATATGATTTGAACTTGTTGGAATTAAATCTCGATTGAAGGAATTATATATGTGAAT
CATGAAAGTTAAAGGTTAAAAGGTTAACTTGGTGTTTAAGATAAACACACAAGATATATAGATAATGGTTAGGGATTTTTTTTAATTATTTGTTTCCTTATAAGAGTAAGATTTTTTACA
AGACTTCTTAACAAGGTTTATTTTAGTATAAAGGGCTAGAATCATTGTATTTTTTTTGTTCTTTGTTCATAATAATTTAGAATTCGTAACTAGTGATTAGTTACATAAGATCATTGTACT
TGTAACGTTTGCTCGATCCAGTTTTCCAACAAACTCTCAATCTCATAAACAGAGAGAAGACATCTTACCACCACACCATTAAATCAATACATTAGATTACAATTTTAATAACTTAACTGT
GGTCATATCTAGCACACTCAATTTCGAAAGACTGGTATTTGGGCCAACTAGTTATGCAATACCACATTGGTCTCTACCCAAAAGTTATCAGTTTTTACCACTTAACCAATTCACTTTGCC
ACCTTTACAACTCAGTACCGTTGCAAATTTATTAATGATTATTTCAAACACACATTTACTTAACATTTTTTTTGGTGTAGGTGGTCACACTATTGGAGTTACTCATTGTTCTTTTATTAA
TGATCGCCTTTACAACTTCAAGAACACTGGGAAACCAGACCCCAACATGGATTGGGAGCTGTTAACATCACTGAGACGTACATGTCCTCAGAATGCAGCAGTAGATCGTGCTATAAACTT
GGATCAAAACCCTTTTAGCTCTTCAGTGGTAGACAAATCTTTCTACAATCAGATTATGCTTCGTAGGGGAGTTTTTCAGATTGATCAAGAGTTGGCAATTGATAGTTTGAGTAAGCCCAC
GGTTGCGGCCATTGCTAGTTCCTCTGATTTCACAACCAAGTTTGGTCAAGCCATGGTTAAGTTGGGTGCCATCCAAGTTCTTACAGGAACACAAGGAGAGATAAGGAGGTCATGCCGAGC
AGTCAACGGACCAACATGGCCTTCTTTATTTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAAACAGTAAAGCAGTTGCATTCATAGCAGCAATTATGTTCATCATCTTGAACCTAACCGGTCACTGCTATGGTGATCTCCAGTTTGGGTTCTACAATGGAAAGTGTCAAAGTTCAG
ACGTTGAAGATATTGTAAGAAGAACGGTTGTCGCTAAATTCTTTTCCGACAAAACGATCGCCCCAGCTCTCATTAGAATGCAGTTTCATGATTGCTTTGTGAAT
GGGTGTGATGCGTCAA
TTCTACTAGACGGAAACAACTCTGAGAAAACCGCATCTCCAAATTTAAGCGTTAGGGGCTACGATGTGATTGATGATGCAAAAGCCGCGGTGGAGAGAGTGTGTCCAGGGGTGGTTTCTT
GTGCTGACATTATCGTTATGGCTACAAGAGACGTTATTTCATTG
AGTGGTGGAGGTAGATACAATGTCCAAACTGGAAGACGAGATGGGACAGTGTCTCTTGCGCAAAACACCGCAAGCC
TCCCATCTCCTTCTACATCGGTATCAAGTGCAATTCAAGCTTTTGCTAGTAAAGGACTAAATGCGACCGACATGATCTATCTTCTTG
GTGGTCACACTATTGGAGTTACTCATTGTTCTT
TTATTAATGATCGCCTTTACAACTTCAAGAACACTGGGAAACCAGACCCCAACATGGATTGGGAGCTGTTAACATCACTGAGACGTACATGTCCTCAGAATGCAGCAGTAGATCGTGCTA
TAAACTTGGATCAAAACCCTTTTAGCTCTTCAGTGGTAGACAAATCTTTCTACAATCAGATTATGCTTCGTAGGGGAGTTTTTCAGATTGATCAAGAGTTGGCAATTGATAGTTTGAGTA
AGCCCACGGTTGCGGCCATTGCTAGTTCCTCTGATTTCACAACCAAGTTTGGTCAAGCCATGGTTAAGTTGGGTGCCATCCAAGTTCTTACAGGAACACAAGGAGAGATAAGGAGGTCAT
GCCGAGCAGTCAACGGACCAACATGGCCTTCTTTATTTAATTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCAAGGAAA AAATAAATGG CAAACAGTAA AGCAGTTGCA TTCATAGCAG CAATTATGTT CATCATCTTG AACCTAACCG GTCACTGCTA TGGTGATCTC CAGTTTGGGT TCTACAATGG  AAAGTGTCAA AGTTCAGACG TTGAAGATAT TGTAAGAAGA ACGGTTGTCG CTAAATTCTT TTCCGACAAA ACGATCGCCC CAGCTCTCAT TAGAATGCAG TTTCATGATT GCTTTGTGAA  TGGGTGTGAT GCGTCAATTC TACTAGACGG AAACAACTCT GAGAAAACCG CATCTCCAAA TTTAAGCGTT AGGGGCTACG ATGTGATTGA TGATGCAAAA GCCGCGGTGG AGAGAGTGTG  TCCAGGGGTG GTTTCTTGTG CTGACATTAT CGTTATGGCT ACAAGAGACG TTATTTCATT GAGTGGTGGA GGTAGATACA ATGTCCAAAC TGGAAGACGA GATGGGACAG TGTCTCTTGC  GCAAAACACC GCAAGCCTCC CATCTCCTTC TACATCGGTA TCAAGTGCAA TTCAAGCTTT TGCTAGTAAA GGACTAAATG CGACCGACAT GATCTATCTT CTTGGTGGTC ACACTATTGG  AGTTACTCAT TGTTCTTTTA TTAATGATCG CCTTTACAAC TTCAAGAACA CTGGGAAACC AGACCCCAAC ATGGATTGGG AGCTGTTAAC ATCACTGAGA CGTACATGTC CTCAGAATGC  AGCAGTAGAT CGTGCTATAA ACTTGGATCA AAACCCTTTT AGCTCTTCAG TGGTAGACAA ATCTTTCTAC AATCAGATTA TGCTTCGTAG GGGAGTTTTT CAGATTGATC AAGAGTTGGC  AATTGATAGT TTGAGTAAGC CCACGGTTGC GGCCATTGCT AGTTCCTCTG ATTTCACAAC CAAGTTTGGT CAAGCCATGG TTAAGTTGGG TGCCATCCAA GTTCTTACAG GAACACAAGG  AGAGATAAGG AGGTCATGCC GAGCAGTCAA CGGACCAACA TGGCCTTCTT TATTTAATTG ATATAAAATA TCATGTGTTT ATTTGTAAAA TTATGCCTGT TATCAGTTAT CTGATTTCAT 
GAGTTTAAGA ATTAAAATAC ATATTTGATT GATTATTATT AGGTATTTTG ACACCCTTGT GCTCTCATCA AACTAAGAAC TAA 

Retrieve as FASTA