Entry information : HaPrx43 (HanXRQChr02g0054341)
Entry ID 13597
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx43 (HanXRQChr02g0054341)
Name (synonym) HaPrx43 (HanXRQChr02g0054341)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx43
start..stop
S start..stop
HaPrx102 535 0 1..330 1..325
HaPrx24 533 0 3..331 1..326
HaPrx42 515 0 3..329 1..325
LperPrx41 479 1e-172 1..283 1..284
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 161120076..161120312 237 N° 2 161119822..161120001 180 N° 3 161119572..161119734 163 N° 4 161118476..161118894 419
complement(join(161118476..161118894,161119572..161119734,161119822..161120001,1 61120076..161120312))


exon

Literature and cross-references HaPrx43 (HanXRQChr02g0054341)
DNA ref. HanXRQ genome:   HanXRQChr02 (161120312..161118476)
Protein sequence: HaPrx43 (HanXRQChr02g0054341)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332
PWM (Da):   %s   35826.2 Transmb domain:   %s   i9-31o
PI (pH):   %s   9.17
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMPNTKAVALAIGFIFLNFAGQCYGYYGYGLQYGFYNGKCRTSDVEAIVRNTVYYKFLKDRSIAPALIRMQFHDCFVNGCDASILLDGPNSEKTAPPNLSVRGYDVIDAAKAAVESVCPGVVSCADIIVMATRDVISFSGGGRYSVQTGRRDGLVSLAQNTISLPPPTSSVSSAIRTFALKGLTATDMIYLLGGHSIGIAHCSLFKDRLYNFKKTGKPDPTMDLALLTSLRRICAQNATVDLSANLDQNPFSSAVVDKSFYSQIMMHRGVLKFDQDVALDSLSKSTVEAIARSSDFNTKFGQAMVKMGAIQVLTGNQGQIRKSCRAIKLQL

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGCCAAATACTAAAGCAGTTGCATTAGCAATTGGGTTCATCTTTTTGAACTTTGCTGGCCAATGCTATGGCTATTACGGCTATGGCCTCCAGTATGGGTTCTATAATGGCAAA
TGTCGAACTTCAGATGTCGAAGCCATCGTAAGAAATACAGTCTACTACAAGTTCCTCAAAGACCGATCAATCGCACCTGCTCTAATTCGAATGCAATTCCATGATTGCTTTGTTAAT
GTA
AGTTTCTTCAATTTTCATGCATGCAAATCAGTTTTGTAAGTCTATGGTTAATCATTCTCTATTTTCCAAAGGGGTGTGACGCATCGATTCTACTAGACGGGCCCAACAGTGAGAAGACCG
CACCTCCGAACTTAAGCGTTAGAGGTTATGATGTCATTGATGCTGCAAAAGCAGCGGTGGAGAGTGTGTGCCCGGGAGTGGTTTCTTGTGCTGATATAATTGTTATGGCTACTAGAGATG
TTATTTCATTT
GTAAGCAGTTGATTTAGATGCATGTGATCATGCTGTAGAGTTTAACTATGTTTAATCTTTTAACATGATTTTATTTATTTAATGTAGAGTGGTGGAGGTAGATACAGTG
TCCAAACAGGAAGAAGGGATGGACTTGTGTCTCTTGCACAAAATACAATTAGTCTCCCACCTCCTACCTCATCTGTATCGAGTGCGATTCGAACCTTTGCTCTGAAAGGACTAACCGCCA
CCGACATGATCTATCTTCTTG
GTAAATCACCTAAAGTTTGAATTCCATCTATCAAAAGTGTTCAATGTAATAAGCAAGCATAACACTAAAAACATAGGACTTTTACTAAAATACAAAGCT
GTCTGTGAATATATCAATCGCGGGTAATTCATATTGGAAAAACCTGTAAATCTGGGCGTGGGTAAAGACTTCACCGAATGACCACTGGTTACTTAGCTACGGATCATCGATATATTTCTC
GTTTTACGTGAAGAATTTTTTGTTGCAAATTCATAATTAAAAAGTTTATACATAGAATTTTTAAAAGAAATAATTTTTCTAGCTTTTTGTTGTTAAAACTATGTTTTCTAGTAGAAATTA
GTTTGAGTGAAAACAAATTATAGTTTGGCATATCTTAAAATGGTGGGGTCAGGTAATTATTTACAAGGGTTTTACACACTAAAGTATTATTATTTTTATATTGGAAAACAATATAACTAC
AATAATAATGTAAATAAAATGGTTGAGAAGGATGCATGAATAGTTACAAATGGATTTTAAACGAATTTCCATCCATCTGATACGTTCTCCTTTTAGCTAACATATTTCTTAGCTTGAGAT
AAAACACAATTCAAATCCAACCATAAGAGTAAATGGATTGGAATTTTTTTACTTCAATTATTGAAAAAATGTTTTCTTAATGTTTCTTTTTTTAACAGGTGGTCACTCGATTGGTATCGC
TCATTGTTCTTTATTTAAAGATCGTCTTTACAACTTCAAGAAAACAGGAAAACCCGATCCTACAATGGATTTAGCGTTGTTAACATCGCTGAGGCGTATATGTGCTCAGAACGCAACCGT
TGATCTCAGTGCAAACTTGGATCAAAATCCTTTTAGCTCTGCTGTTGTAGACAAATCTTTCTATAGTCAGATTATGATGCATAGGGGAGTCCTTAAATTCGATCAAGACGTGGCATTGGA
TAGTTTGAGCAAGTCCACTGTTGAAGCCATTGCGCGTTCATCTGATTTCAACACTAAATTTGGTCAAGCCATGGTTAAGATGGGTGCCATCCAAGTTCTCACAGGAAATCAAGGACAGAT
AAGGAAATCATGCCGAGCAATCAAGCTCCAACTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGCCAAATACTAAAGCAGTTGCATTAGCAATTGGGTTCATCTTTTTGAACTTTGCTGGCCAATGCTATGGCTATTACGGCTATGGCCTCCAGTATGGGTTCTATAATGGCAAA
TGTCGAACTTCAGATGTCGAAGCCATCGTAAGAAATACAGTCTACTACAAGTTCCTCAAAGACCGATCAATCGCACCTGCTCTAATTCGAATGCAATTCCATGATTGCTTTGTTAAT
GGG
TGTGACGCATCGATTCTACTAGACGGGCCCAACAGTGAGAAGACCGCACCTCCGAACTTAAGCGTTAGAGGTTATGATGTCATTGATGCTGCAAAAGCAGCGGTGGAGAGTGTGTGCCCG
GGAGTGGTTTCTTGTGCTGATATAATTGTTATGGCTACTAGAGATGTTATTTCATTT
AGTGGTGGAGGTAGATACAGTGTCCAAACAGGAAGAAGGGATGGACTTGTGTCTCTTGCACAA
AATACAATTAGTCTCCCACCTCCTACCTCATCTGTATCGAGTGCGATTCGAACCTTTGCTCTGAAAGGACTAACCGCCACCGACATGATCTATCTTCTTG
GTGGTCACTCGATTGGTATC
GCTCATTGTTCTTTATTTAAAGATCGTCTTTACAACTTCAAGAAAACAGGAAAACCCGATCCTACAATGGATTTAGCGTTGTTAACATCGCTGAGGCGTATATGTGCTCAGAACGCAACC
GTTGATCTCAGTGCAAACTTGGATCAAAATCCTTTTAGCTCTGCTGTTGTAGACAAATCTTTCTATAGTCAGATTATGATGCATAGGGGAGTCCTTAAATTCGATCAAGACGTGGCATTG
GATAGTTTGAGCAAGTCCACTGTTGAAGCCATTGCGCGTTCATCTGATTTCAACACTAAATTTGGTCAAGCCATGGTTAAGATGGGTGCCATCCAAGTTCTCACAGGAAATCAAGGACAG
ATAAGGAAATCATGCCGAGCAATCAAGCTCCAACTTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAATACCAAA CACTCATTTC TTCTTATTCA CCCCAATTCA AATAACAATT TGCATAACAA AATGGCCATG CCAAATACTA AAGCAGTTGC ATTAGCAATT GGGTTCATCT TTTTGAACTT  TGCTGGCCAA TGCTATGGCT ATTACGGCTA TGGCCTCCAG TATGGGTTCT ATAATGGCAA ATGTCGAACT TCAGATGTCG AAGCCATCGT AAGAAATACA GTCTACTACA AGTTCCTCAA  AGACCGATCA ATCGCACCTG CTCTAATTCG AATGCAATTC CATGATTGCT TTGTTAATGG GTGTGACGCA TCGATTCTAC TAGACGGGCC CAACAGTGAG AAGACCGCAC CTCCGAACTT  AAGCGTTAGA GGTTATGATG TCATTGATGC TGCAAAAGCA GCGGTGGAGA GTGTGTGCCC GGGAGTGGTT TCTTGTGCTG ATATAATTGT TATGGCTACT AGAGATGTTA TTTCATTTAG  TGGTGGAGGT AGATACAGTG TCCAAACAGG AAGAAGGGAT GGACTTGTGT CTCTTGCACA AAATACAATT AGTCTCCCAC CTCCTACCTC ATCTGTATCG AGTGCGATTC GAACCTTTGC  TCTGAAAGGA CTAACCGCCA CCGACATGAT CTATCTTCTT GGTGGTCACT CGATTGGTAT CGCTCATTGT TCTTTATTTA AAGATCGTCT TTACAACTTC AAGAAAACAG GAAAACCCGA  TCCTACAATG GATTTAGCGT TGTTAACATC GCTGAGGCGT ATATGTGCTC AGAACGCAAC CGTTGATCTC AGTGCAAACT TGGATCAAAA TCCTTTTAGC TCTGCTGTTG TAGACAAATC  TTTCTATAGT CAGATTATGA TGCATAGGGG AGTCCTTAAA TTCGATCAAG ACGTGGCATT GGATAGTTTG AGCAAGTCCA CTGTTGAAGC CATTGCGCGT TCATCTGATT TCAACACTAA  ATTTGGTCAA GCCATGGTTA AGATGGGTGC CATCCAAGTT CTCACAGGAA ATCAAGGACA GATAAGGAAA TCATGCCGAG CAATCAAGCT CCAACTTTAA CTTCTAAAAC AATTAATTTG  CATGGTTTCC TTCATATTTT TTTTGTCATT TTTATCTGAT GTTGTTCTGT GATTTTTTTT TGTTGTTGAC ATATCTTTAA CCATTTGATT TTGTTTTCTA TCGAGTAATG TATTTTTTTC  TTCAATTTTT GCAAGGGTTT GGTTGAGAAG TTTTTTTTCT TTTTTTAAAT ATATGTATTA ATGTTGTCAG ATTGACAAAA CTTTTGTGTT TGGAATTTAG ATTTCCTCGT GTAATTTAAC 
GAGTTGACC 

Retrieve as FASTA