Entry information : HaPrx45 (HanXRQChr03g0085081)
Entry ID 13599
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx45 (HanXRQChr03g0085081)
Name (synonym) HaPrx45 (HanXRQChr03g0085081)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx45
start..stop
S start..stop
HaPrx96 625 0 1..329 1..329
HaPrx134 620 0 1..328 1..328
HaPrx62 605 0 1..329 1..329
HaPrx74 437 3e-155 10..329 7..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 142589381..142589602 222 N° 2 142589089..142589271 183 N° 3 142588789..142588951 163 N° 4 142584309..142584730 422
complement(join(142584309..142584730,142588789..142588951,142589089..142589271,1 42589381..142589602))


exon

Literature and cross-references HaPrx45 (HanXRQChr03g0085081)
DNA ref. HanXRQ genome:   HanXRQChr03 (142589602..142584309)
Protein sequence: HaPrx45 (HanXRQChr03g0085081)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   36048.36 (33229.8)  
PI (pH):   %s   5.06 (4.92) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLIKMNMGVLTIIIIFEFLVVANSQDQLKVGFYNQVCPKAESVVTNIVRDAGKFDHRIPPGLLRLHFHDCFVEGCDGSILIDKGNTSEKGAFEHQGLTGFNIIEDAKAKLESICPGVVSCADIVAMAARDAVAFSHGPVYQVETGRKDVLVSNIDLANRMPDVRDSIELLKQKFIEKGLNEKDLVILSAAHTIGSTACFFMEERLYNFASLGGPDPSINPRLLPELTLTCPINGDVGIRLPMDLGSEDTFDIQILQNIRSGFAVLQSDAKLMDDLTTRGIVDSYFDVWAPFFGPSFEADFVISMLRMGRIGVKTGSNGNIRRQCTSFN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATTGATCAAAATGAACATGGGGGTGCTGACTATCATAATAATTTTTGAGTTTTTAGTTGTAGCTAATTCACAAGATCAACTCAAAGTAGGGTTTTACAATCAGGTGTGTCCAAAA
GCAGAATCGGTGGTTACTAATATCGTGAGAGACGCAGGAAAGTTCGACCATCGTATTCCTCCTGGCTTGCTCAGGCTTCACTTTCATGACTGCTTTGTTGAG
GTTCTCCATCTCTCACAA
ACACATTTATAAATTTATTAAATGACCGGTTTGTGATCGTTTATGTCGTCATCTTTGTAGCAGTATTTCTTACAATTGTGTTTATATGTAGGGGTGTGATGGGTCCATATTAATAGATAA
GGGTAACACTTCAGAGAAAGGTGCATTCGAGCATCAAGGGTTAACAGGGTTTAACATAATAGAGGATGCAAAAGCAAAGTTGGAAAGTATATGTCCTGGTGTGGTTTCGTGTGCGGATAT
TGTGGCCATGGCTGCAAGAGATGCTGTTGCATTC
GTAAGTTAAAGAACACGTACAATCACAATCTGAATGAATCAATCTATCTCTCTCTCTCACATACACATATACGTACAATGTGTGTG
AGACAAAGAGAGTCAAAATGACATCTAATAATGATTGTTTTTTTCTGACAGAGTCATGGACCAGTTTATCAAGTTGAAACAGGAAGGAAGGATGTTCTAGTGTCAAATATTGATCTTGCT
AATAGAATGCCTGATGTGAGAGATTCAATTGAGCTTCTGAAACAAAAGTTCATTGAGAAGGGGCTTAATGAAAAAGACCTTGTGATTCTTAGTG
GTAAGTTTGTTCGGTTTATATTTATT
TAATCTTTTGGAAAAATTACAAAAATAGTTATGTTGACCAAACAATTTTCTAAGTCAAGGAAATTTAGTCTTTACCAAAGTACTTATCACTCATTTCCGCAAATTGAAAGCCCGCTACAT
AAGCTTCATCAATTGAGATGGCGAAAATTTAGCCTACACTTTTGGCCGTCGGCTAAGACTGCACTTTTAGCAAAAGGGTCGGCCAAGTCTGCGCCTTTGGGTGCATGCTAAGAGTTAACC
ACGCCTTTTGAAGACGGCTAAGATTCACCGACTATTTTTTTTAAATATTTGATCAACTACACTATTTTGATAATTTTCTTTAATCTTTTGGGTTCCATTCATGCACTTTGAAATGTTATA
GGATATCTTTCAACATAGTTAACAATATATATGTGTGTTATTAATCATAATATTTACTATTTCTGTGATTATACAAAGCATATTCTTTCCTGCCTGAAATGCTTTTATTGTTTCATAAAT
GAAAGCAAATCGTCTAGTTTTCTAAGTAGGGAATTTTAAAAAATTATATTTTGGAGTATATTTATACAGTACGTATATTTATCCATTTTAAAAAATTATATTTTGGAATATATTTATACA
GTACGTATATTTATCCATTTAATATACGTTCCTGAATTAATAAAAATACATCTGGAAAATGAAGTAGATATGTGTGAAAATTAGATACTTAATAAAAAGCGACATGTAGCCCACTCATAA
GCTTATATATTTAAAGCATTAATTATTTATAGAGTTAATTACTGTTTTCGTCCCTGAGGTTTGTCAAAAATAACGGTTTCAGTCCATTAGTTTAAAAATTGCGATTTCAGTCCATTAGTT
TCATTTTCGTAACCATTTCAGTCCACTAACTTAACTCCATCCATTTATTTTGTTAACTTTGAGTTAACTAACTAATTCAGGGATGGTTTGCGTCAGTTTTAAAAACACAGGGACTTAAGT
GTAAACTCTAAAACATTAAAACAAAAAAAAATAGTAAATTCCAAAAAATCAAAAAAATTAAAAAAAAAAACCAAACAAATTCCAAAAAATTCTAAAAAATAATAAAAATTCTAAAAAATC
ATAAAAATTCTAAAAAATTCTAAAAAATCCAAAAAATCCGTTTCGGCGCGAACTGTTTCGAACCTAAACCGTTTCGAGCTTAACCGTTTCGACGCGAACCGTTTCGACCCGAACCGTTTC
GAGCTGAACCGTCCGTACCGTTTCGACGCGAACCGTTTCGACCCGTACCGTTTCGAGCCGAACCGTTTCGACCCGTACCGTTTCGAAGCCGAATCGTTTCGAGCTGAACCGTTTCGAACC
GAACCGTTTCGACCCGTACCGTTTCGAAGCCGAACCGTTTCAAGCCATACCGTTTCGAACCGAACCGTTTCGAGCTGAACCGTTTCGAACCGAACCGTGCCGTATCGAACCGAACCGTTT
CAAGCTGTACCGTTTCGACGCGAACCGTGCCGTATCGAACCGTGCCGTATCGAACCGAAACGGTTCGGCTTCGAAACGGTACAGCTTCGAAACGGTTCGGGTCGAAACAGTACGGTTCGA
TACGGTTCAACTCGAAACGGTTCGGTTCGATACGGCACGGTTCGGTTCGAAACGGTTCAGCTCGAAACGGTTCGGTTCGAAACGGCACGGTTCGGTTCGAAACGGTACGGCTTGAAACGG
TTTTCGAGACGGTTCGGTTCGAAACGGTTCAGCTCGAAACGGTTCGGCTTCGAAACGGTAAGGGTCGAAACGGTTCGGCTCGAAACGGTTCGGGTCGAAACGGTACGGATGGTTCAGCTC
GAAACGGTTCGGGTTCGAAACAGTTTGCGCCGAAACGGATTTTTTGGATTTTTTAGAATTTTTTAGAATTTTTATGATTTTTTAGAATTATTATTATTTTTTAGAATTTTTTGGAATTTG
TTTGGTTTTTTGAAATTTTTTTGATTTTTTGGAATTTACTATTTTTTTTGTTTTAATGTTTTAGAGTTTACACTTAAGTCCCTGTGTTTCTAAAACTGACGCAAACCGTCCCTGAATTAG
TTAGTTAACTCAAAGTTAACAAAATAAATGGATGGAGTTAAGTTAGTGGACTGAAATGGTTACGAAAATGAAACTAATGGACTGAAATCGCAATTTTTAAACTAATGGACTGAAACCGTT
ATTTTTGACAAACCTCAGGGACGAAAACAGTAATTAACTCTTATTTATATTGATACTAGGTTAGAACCCCGTGTATTACACGGGGTTGAGTAAATGTAATTTTATATATTAAATAATAAA
AAGTTATATTTTTATGAACCATGTATATTGAATAATAAGGATGAATTATTTACTTTCATTTATGCAACTTGTGTAATACACGGGGTTTTTAAAAAATATAACTTTTTATTATGTAGTATA
TAAAATTAAATTTATTCAATCTATATAATACACAGGGTTTATAAAGATATAACTTTTTATTGTTTAGTATATAATGTGCTCAACCCGTATAACACATGAGATTCTTAAAAATGTAACTTT
TTTTCATTATTTAATATATAAAATTAAATTTACTCAACCCGTACAATACATGGGGTTCTCAAAGATATAACTTTTTTTATTATTTAATATATAAAATTACATTTATTCAACCTGTGTAAC
ACACGAGATTCTAACCTAGTAAATGAATAATTGAATATTTATCTAAATAATCAATATTTTTCAAACACTAACATCTGAGATAACTTTACATGACCGAACTATTTAGATAACAAACTTAAG
AAAAATAATCAATATTTTTCAAACACTAACATCTCAAATAACTTTACATGATCGCACTATTTAGATAAAAAGAAAATGAAATTGTTTTAATGATAAATATTTTAAAATATTATATTATCA
ATTTATATTAAATTAAATTTTATAATTATCTTTTAATTTAATTGATATTATTAATTAACTATAAAAAATAGATGGCTTCAATGGATGACATGTGTCCTCTCATTGGTTTCTTTTATTATA
TAGTAAGATGTGAGCATAAATTAAAGTTTGTAAGGAATATTTTGTGTACTTCGTTAATATAGACTTTATCTGCATAAATTACAAATAAATGTATAAAAAATAATTTCTCATGAGTTTCTT
TTTTTCTTTTAATAATAATTTACGATATTTGAACATCAGTTCAAAACAACAAAATTAGATTAATTGACATGGTCCACTCAGAAATTAAGTTGACATCACAAGGGGTCGAATACGAATGTT
AACAATTTAACATGTAATCAAAGTCAAGCTATAAATACATGAAAAGAAAATAATGTATTTTCACCTGGTTGCGTAGGTAAAATTTAAAGGCATAATGTTGTAATGCCCCCGTATCATGTG
CACTAATGTTTGTAATAAATATTGTTTTTCGTTAGAACACAATTTGTATATTGAAATATGTATATTAAAAGTTTGTAACAAAAACATGAATAAAATTATATGCGAATTATATATTTTTTG
AAGAACCATTAGTAATTATAAATTTAGAATATTATATAGCTTTTTAATATTTTATTATTTGAATATGTTATAGTATAACATTATACTTATTTTTAACATATTTTCAAATTTTTTCCTTTT
ATTATTATATGCACTTTTTACATATTTTCTTTTTTTTCTTTTCTAAAATCATATATCCTTTCTCATTTATTTTTTATTTTTAATAATCCTTTTTTTTAAATAATCTTTACTTTATCAATT
ATTTTGATATTTCTTTATTAACTTATGTTCGTACATTTTGTTTTCTAAAAACTTAAGTACGTAGTTGTGCTTTATTTTTACCCCCGACCAGTACAAGTTTTATAAAAACCGAAGTTGTAC
TCAAAATAGAGTATGTATCTGGTAGCGTAAAATGGTACGATGATAAACTGAATCGATTCTAACGGTTGGGCTTTCTAAACAACATGTTTCATTTTCAAATAACGTTTGTTTTAAATTATC
ATTTGCTTTGTTTCGCCGCAACGCGCGACAAAAAACCTAGTTTTAATAGTTTCTTTTATCGATAATATTCAGCTGCACATACTATTGGTTCAACTGCGTGCTTCTTCATGGAGGAACGAC
TCTACAACTTTGCATCGCTTGGTGGTCCAGACCCGAGTATCAACCCTCGTTTGCTACCTGAACTGACATTGACATGCCCTATAAATGGAGACGTTGGCATCAGATTACCAATGGATCTTG
GGAGTGAAGACACATTTGACATTCAAATCCTACAAAACATTAGGAGTGGTTTTGCGGTGCTACAATCTGATGCAAAGCTTATGGACGACCTGACAACAAGGGGAATAGTAGATTCGTATT
TCGATGTGTGGGCTCCGTTTTTTGGACCATCATTTGAGGCGGATTTTGTGATTTCCATGTTAAGAATGGGCAGAATTGGGGTCAAGACCGGTTCTAATGGAAATATTAGGCGTCAATGTA
CATCATTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATTGATCAAAATGAACATGGGGGTGCTGACTATCATAATAATTTTTGAGTTTTTAGTTGTAGCTAATTCACAAGATCAACTCAAAGTAGGGTTTTACAATCAGGTGTGTCCAAAA
GCAGAATCGGTGGTTACTAATATCGTGAGAGACGCAGGAAAGTTCGACCATCGTATTCCTCCTGGCTTGCTCAGGCTTCACTTTCATGACTGCTTTGTTGAG
GGGTGTGATGGGTCCATA
TTAATAGATAAGGGTAACACTTCAGAGAAAGGTGCATTCGAGCATCAAGGGTTAACAGGGTTTAACATAATAGAGGATGCAAAAGCAAAGTTGGAAAGTATATGTCCTGGTGTGGTTTCG
TGTGCGGATATTGTGGCCATGGCTGCAAGAGATGCTGTTGCATTC
AGTCATGGACCAGTTTATCAAGTTGAAACAGGAAGGAAGGATGTTCTAGTGTCAAATATTGATCTTGCTAATAGA
ATGCCTGATGTGAGAGATTCAATTGAGCTTCTGAAACAAAAGTTCATTGAGAAGGGGCTTAATGAAAAAGACCTTGTGATTCTTAGTG
CTGCACATACTATTGGTTCAACTGCGTGCTTC
TTCATGGAGGAACGACTCTACAACTTTGCATCGCTTGGTGGTCCAGACCCGAGTATCAACCCTCGTTTGCTACCTGAACTGACATTGACATGCCCTATAAATGGAGACGTTGGCATCAGA
TTACCAATGGATCTTGGGAGTGAAGACACATTTGACATTCAAATCCTACAAAACATTAGGAGTGGTTTTGCGGTGCTACAATCTGATGCAAAGCTTATGGACGACCTGACAACAAGGGGA
ATAGTAGATTCGTATTTCGATGTGTGGGCTCCGTTTTTTGGACCATCATTTGAGGCGGATTTTGTGATTTCCATGTTAAGAATGGGCAGAATTGGGGTCAAGACCGGTTCTAATGGAAAT
ATTAGGCGTCAATGTACATCATTTAATTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TATTTGATAC CACTCTCCCT TCCTTTCTTC ATCCATTTCA TATTCTTTTT AACAAATACA TCATGAAATT GATCAAAATG AACATGGGGG TGCTGACTAT CATAATAATT TTTGAGTTTT  TAGTTGTAGC TAATTCACAA GATCAACTCA AAGTAGGGTT TTACAATCAG GTGTGTCCAA AAGCAGAATC GGTGGTTACT AATATCGTGA GAGACGCAGG AAAGTTCGAC CATCGTATTC  CTCCTGGCTT GCTCAGGCTT CACTTTCATG ACTGCTTTGT TGAGGGGTGT GATGGGTCCA TATTAATAGA TAAGGGTAAC ACTTCAGAGA AAGGTGCATT CGAGCATCAA GGGTTAACAG  GGTTTAACAT AATAGAGGAT GCAAAAGCAA AGTTGGAAAG TATATGTCCT GGTGTGGTTT CGTGTGCGGA TATTGTGGCC ATGGCTGCAA GAGATGCTGT TGCATTCAGT CATGGACCAG  TTTATCAAGT TGAAACAGGA AGGAAGGATG TTCTAGTGTC AAATATTGAT CTTGCTAATA GAATGCCTGA TGTGAGAGAT TCAATTGAGC TTCTGAAACA AAAGTTCATT GAGAAGGGGC  TTAATGAAAA AGACCTTGTG ATTCTTAGTG CTGCACATAC TATTGGTTCA ACTGCGTGCT TCTTCATGGA GGAACGACTC TACAACTTTG CATCGCTTGG TGGTCCAGAC CCGAGTATCA  ACCCTCGTTT GCTACCTGAA CTGACATTGA CATGCCCTAT AAATGGAGAC GTTGGCATCA GATTACCAAT GGATCTTGGG AGTGAAGACA CATTTGACAT TCAAATCCTA CAAAACATTA  GGAGTGGTTT TGCGGTGCTA CAATCTGATG CAAAGCTTAT GGACGACCTG ACAACAAGGG GAATAGTAGA TTCGTATTTC GATGTGTGGG CTCCGTTTTT TGGACCATCA TTTGAGGCGG  ATTTTGTGAT TTCCATGTTA AGAATGGGCA GAATTGGGGT CAAGACCGGT TCTAATGGAA ATATTAGGCG TCAATGTACA TCATTTAATT AACATGATAG AATAAAAGGA GCTAGTGTCT 
CTTG 

Retrieve as FASTA