Entry information : HaPrx48 (HanXRQChr04g0109361)
Entry ID 13602
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx48 (HanXRQChr04g0109361)
Name (synonym) HaPrx48 (HanXRQChr04g0109361)
Class Class III peroxidase    [Orthogroup: Prx052]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx48
start..stop
S start..stop
HaPrx99 538 0 7..341 7..341
HaPrx105 479 3e-171 3..340 21..360
LsePrx49 446 4e-159 11..306 7..304
LvPrx49 437 8e-156 11..283 7..281
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 87465102..87465380 279 N° 2 87465464..87465806 343 N° 3 87465888..87466300 413  
join(87465102..87465380,87465464..87465806,87465888..87466300)


exon

Literature and cross-references HaPrx48 (HanXRQChr04g0109361)
DNA ref. HanXRQ genome:   HanXRQChr04 (87465102..87466300)
Protein sequence: HaPrx48 (HanXRQChr04g0109361)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344 (319)
PWM (Da):   %s   38229.76 (35557.4) Transmb domain:   %s   i7-26o
PI (pH):   %s   9.37 (9.36) Peptide Signal:   %s   cut: 26 range:26-344
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKNCASMTIAIISLLSILFFMSVSASNDRSLLTLPSLLDDATSFEEGLSNSLYHKSCHDVEGVIFRKVMEWVKKDPSLAPSLIRLHFHDCVLRGCDASILLNHSGSERSADVSKSLRGFQVIDDIKAELEKKCPRTVSCADILTTAARDATVLAGGPFWSIPFGRKDGRISLAKEATNVPMGRESVTKLIELFESKGLNVLDLVVLSGAHTIGRSTCESVQHRLYNYKGTKKPDPSINPVYLNYLRKKCRSTSGNVFLDATTPKAFDIHYFRNLKKKMGLLSTDQSLYSDLRTKPFVNALFNESSLFFNQFSVSMVKLGNILDAKSQEKGEIRINCNRVNYRHV

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAATTGTGCTAGCATGACCATCGCTATCATCTCACTCTTGTCGATCTTGTTTTTCATGTCGGTTTCGGCCTCAAACGATAGGTCGTTACTAACTTTACCAAGCCTGTTAGATGAT
GCTACATCCTTCGAGGAAGGTCTTTCGAACTCTTTATATCATAAAAGTTGTCACGATGTTGAAGGGGTCATCTTTAGGAAAGTCATGGAATGGGTTAAAAAGGACCCCTCTCTCGCGCCT
AGTCTTATCCGATTACATTTTCACGATTGTGTCCTTAGG
GTAAACGATCCTTTAATCACTTATAGTTAGTTATTTTTTTGGGCTTCTTGTTGGTATGTATATATTTGTGTTTGGTTTTGT
AGGGATGTGATGCTTCAATACTTTTAAACCATAGTGGAAGTGAAAGGTCCGCGGATGTAAGCAAGTCGTTAAGAGGGTTCCAAGTGATCGATGATATCAAGGCGGAGCTTGAGAAGAAAT
GCCCTAGAACAGTCTCATGTGCTGACATCTTGACGACTGCTGCTAGAGATGCCACAGTTTTAGCTGGTGGACCCTTTTGGTCCATACCATTTGGAAGGAAAGATGGACGTATTTCCCTCG
CGAAGGAAGCCACAAACGTCCCCATGGGTCGTGAAAGTGTTACCAAACTTATTGAGCTCTTTGAGTCCAAGGGTTTGAATGTTCTTGACTTGGTTGTCCTCTCAG
GTAATACATAGGTTT
AGCGTTCATCTTTTATGATAAATGTATTTCTTAAATGCCAACAAAATATGATACTTTTGTTTGTAGGTGCACACACTATAGGAAGGAGTACATGTGAGTCAGTGCAACATCGGCTATACA
ACTACAAAGGAACAAAGAAACCCGATCCATCTATCAATCCTGTATACTTGAACTACTTGAGGAAAAAGTGTCGATCAACGTCAGGAAATGTGTTTCTTGATGCCACAACCCCGAAAGCAT
TCGATATACATTATTTCCGTAATCTTAAGAAGAAGATGGGGCTCTTGTCTACGGACCAGTCCCTCTACTCTGATTTAAGGACTAAACCTTTTGTGAATGCGTTGTTTAACGAATCTTCAC
TATTCTTCAACCAATTTAGTGTTTCCATGGTGAAGCTTGGAAATATTCTTGATGCTAAGTCTCAAGAAAAGGGTGAAATACGCATTAATTGCAATCGTGTGAACTATCGACATGTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAATTGTGCTAGCATGACCATCGCTATCATCTCACTCTTGTCGATCTTGTTTTTCATGTCGGTTTCGGCCTCAAACGATAGGTCGTTACTAACTTTACCAAGCCTGTTAGATGAT
GCTACATCCTTCGAGGAAGGTCTTTCGAACTCTTTATATCATAAAAGTTGTCACGATGTTGAAGGGGTCATCTTTAGGAAAGTCATGGAATGGGTTAAAAAGGACCCCTCTCTCGCGCCT
AGTCTTATCCGATTACATTTTCACGATTGTGTCCTTAGG
GGATGTGATGCTTCAATACTTTTAAACCATAGTGGAAGTGAAAGGTCCGCGGATGTAAGCAAGTCGTTAAGAGGGTTCCAA
GTGATCGATGATATCAAGGCGGAGCTTGAGAAGAAATGCCCTAGAACAGTCTCATGTGCTGACATCTTGACGACTGCTGCTAGAGATGCCACAGTTTTAGCTGGTGGACCCTTTTGGTCC
ATACCATTTGGAAGGAAAGATGGACGTATTTCCCTCGCGAAGGAAGCCACAAACGTCCCCATGGGTCGTGAAAGTGTTACCAAACTTATTGAGCTCTTTGAGTCCAAGGGTTTGAATGTT
CTTGACTTGGTTGTCCTCTCAG
GTGCACACACTATAGGAAGGAGTACATGTGAGTCAGTGCAACATCGGCTATACAACTACAAAGGAACAAAGAAACCCGATCCATCTATCAATCCTGTA
TACTTGAACTACTTGAGGAAAAAGTGTCGATCAACGTCAGGAAATGTGTTTCTTGATGCCACAACCCCGAAAGCATTCGATATACATTATTTCCGTAATCTTAAGAAGAAGATGGGGCTC
TTGTCTACGGACCAGTCCCTCTACTCTGATTTAAGGACTAAACCTTTTGTGAATGCGTTGTTTAACGAATCTTCACTATTCTTCAACCAATTTAGTGTTTCCATGGTGAAGCTTGGAAAT
ATTCTTGATGCTAAGTCTCAAGAAAAGGGTGAAATACGCATTAATTGCAATCGTGTGAACTATCGACATGTTTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GATCCATCGC ATTTTAGAGA GTAACCATGA AGAATTGTGC TAGCATGACC ATCGCTATCA TCTCACTCTT GTCGATCTTG TTTTTCATGT CGGTTTCGGC CTCAAACGAT AGGTCGTTAC  TAACTTTACC AAGCCTGTTA GATGATGCTA CATCCTTCGA GGAAGGTCTT TCGAACTCTT TATATCATAA AAGTTGTCAC GATGTTGAAG GGGTCATCTT TAGGAAAGTC ATGGAATGGG  TTAAAAAGGA CCCCTCTCTC GCGCCTAGTC TTATCCGATT ACATTTTCAC GATTGTGTCC TTAGGGGATG TGATGCTTCA ATACTTTTAA ACCATAGTGG AAGTGAAAGG TCCGCGGATG  TAAGCAAGTC GTTAAGAGGG TTCCAAGTGA TCGATGATAT CAAGGCGGAG CTTGAGAAGA AATGCCCTAG AACAGTCTCA TGTGCTGACA TCTTGACGAC TGCTGCTAGA GATGCCACAG  TTTTAGCTGG TGGACCCTTT TGGTCCATAC CATTTGGAAG GAAAGATGGA CGTATTTCCC TCGCGAAGGA AGCCACAAAC GTCCCCATGG GTCGTGAAAG TGTTACCAAA CTTATTGAGC  TCTTTGAGTC CAAGGGTTTG AATGTTCTTG ACTTGGTTGT CCTCTCAGGT GCACACACTA TAGGAAGGAG TACATGTGAG TCAGTGCAAC ATCGGCTATA CAACTACAAA GGAACAAAGA  AACCCGATCC ATCTATCAAT CCTGTATACT TGAACTACTT GAGGAAAAAG TGTCGATCAA CGTCAGGAAA TGTGTTTCTT GATGCCACAA CCCCGAAAGC ATTCGATATA CATTATTTCC  GTAATCTTAA GAAGAAGATG GGGCTCTTGT CTACGGACCA GTCCCTCTAC TCTGATTTAA GGACTAAACC TTTTGTGAAT GCGTTGTTTA ACGAATCTTC ACTATTCTTC AACCAATTTA  GTGTTTCCAT GGTGAAGCTT GGAAATATTC TTGATGCTAA GTCTCAAGAA AAGGGTGAAA TACGCATTAA TTGCAATCGT GTGAACTATC GACATGTTTG AAACAACATC AACATGCATG  GAGTATTTTG ATCATACATG TTTTGTTATG CTCATTGTCT TTGTAATAAA AGTTATATCT CTATTCATAA ATAGATATCA TGCAACTTCT AATCGGTAAA ATGTTCCTGT TTTCTATATT 
TCTTTTAAGT AACGATAAT 

Retrieve as FASTA