Entry information : HaPrx51 (HanXRQChr05g0146571)
Entry ID 13605
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx51 (HanXRQChr05g0146571)
Name (synonym) HaPrx51 (HanXRQChr05g0146571)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx51
start..stop
S start..stop
HaPrx82 596 0 27..362 26..360
HaPrx83 586 0 41..362 1..322
HaPrx87 586 0 41..362 1..322
HaPrx86 582 0 41..362 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 138198793..138199134 342 N° 2 138200021..138200209 189 N° 3 138200304..138200466 163 N° 4 138200977..138201371 395
join(138198793..138199134,138200021..138200209,138200304..138200466,138200977..1 38201371)


exon

Literature and cross-references HaPrx51 (HanXRQChr05g0146571)
DNA ref. HanXRQ genome:   HanXRQChr05 (138198793..138201371)
Protein sequence: HaPrx51 (HanXRQChr05g0146571)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362
PWM (Da):   %s   39446.97  
PI (pH):   %s   9.45
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTSTLSSSILFITNSNISLNHLHQNLKFQTPPESSLLPTMAAKNTTIFSFFSTLIFFGLIHSNQIDALNTNYYDHTCPNVESTITSVVKKAMMNDPTVPAALLRMHFHDCFIRGCDGSVLLNSTGKNKAEKDGPPNISLHAFYVIDNAKKALESLCPKTVSCADILALAARDAVTLSGGPTWDVPKGRKDGRISKATETRQLPAPTFNISQLQQSFAQRSLSMDDLVALSGGHTLGFSHCSSFQNRIHNFNSKQSVDPALQSSFAARLKSICPAHNTVKKAGANLDSTPTTFDNRYYKLLLQGKSIFSSDQALVTMANTKTLVSKFASSQHEFEKAFVKSMIKMSSIHGGQEVRLDCRVVN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAACCTCTACATTGTCGTCTTCAATTCTTTTCATTACAAATAGCAACATTTCTCTCAATCATCTTCATCAAAACTTAAAGTTTCAAACACCACCAGAAAGTTCTTTGCTTCCAACA
ATGGCAGCCAAGAACACCACCATCTTTTCCTTTTTTTCAACTCTCATTTTCTTCGGTTTAATCCATTCTAATCAGATTGATGCGCTGAATACTAACTACTACGATCACACATGCCCCAAT
GTCGAATCAACCATTACAAGTGTTGTGAAGAAAGCTATGATGAATGATCCAACAGTTCCTGCTGCGCTTCTTAGAATGCATTTTCATGATTGCTTCATCAGG
GTGACGATTCTTCTATCG
CTTAAATCTTTTACATGTGTATACGCACACCTAATAAATTTCTATCGCTTAAATCTTTTACATGTGTATACGCACACCTAATAAATAAGGAAATGGTTGCGCCACGTGTCCCGTGGGCCC
AAGATTCTCTTTCCCACTTCTCTTATTTCATTTTTTCATATTTTCTTATTTTTAATAATTAATTTTTAAAAAAGAATAACAGTAACATGTTATCATATATTAAATTAATAGTTAGTAACT
TATATGGAATTTCAATCATATCCTATCTCAAAATATTGTTTTATAATTCTTAATTTCCATTCCTAACTATTTAATATTTACCATTATCCAACACGTGCATTATATATTACAAAGGTTAAT
TTATAACCTAGTGTATATATATACACAGGACATATACAAGTATAATTGTTGTAATCACTATATCATTTTGTTTGATTACTGACACGACTATATAACCAAGTATTTGTTACGGCCAAATAT
ACTAGCAAATGCGCAGCGAAAGCCAATTTTGCTACGTTTGGTCCTTAGCTATTCATCTCGTCGCTAATCACTTTTCCCACGGAATCACATTTGCTGTGGTTTTAGCGACAGAAAAATGTC
ACTATTTTAGTTATGGATTTTGCTACGTATTTTTTATTAGAAATTTGGGCTAAGAAATTTTGCTAAGGAATTATTTTCATAACTTCTACTAAGGATTCAGCTACAGAAGTTTGCACGGTT
TTTCTCTAGATTTTTTCTAGAACCTAAAAAAAGAAGTTTCCTTTTTATGTATTATATCATTTTTTTTTCTTGTAAACAAGATATTCAAATTCTCTGAAATAGATACAAAAATCATAGTAG
TGTGATGACTAAATATTTGTTTTTGAAGGGCTGTGACGGTTCGGTGTTGTTGAATTCAACTGGAAAGAACAAAGCTGAGAAAGATGGACCACCAAACATATCTTTGCATGCATTTTATGT
AATTGATAATGCCAAGAAAGCACTAGAGTCTTTATGCCCCAAGACTGTTTCTTGTGCAGATATTTTGGCATTAGCTGCAAGGGATGCAGTCACTTTG
GTCAGTAATGCATGGTTTAAAAT
CTTACATATACAGATTTCACATGTTTTGATCTTAACTCTTAATATTATTCTTTTGTGTGATTCGAATGTAGTCCGGAGGGCCAACATGGGATGTTCCCAAAGGAAGAAAAGATGGAAGAA
TCTCAAAAGCAACCGAAACCCGACAATTACCCGCTCCAACATTCAATATTTCTCAGCTTCAACAAAGTTTTGCTCAGAGAAGTCTTTCTATGGATGATTTAGTTGCACTCTCAG
GTAAAT
AAACTAGTTTTGGAGGCAACAAAGTTTTGCTTACATGGACACATTGGTGACTGACTTTTAACTTTTAGTAACTGGCCTTTCACTTGCTAAATTATTACTTTCAGTGCCTGACGTTTTACT
TTTAGTTTTATTTTTTTTTTTCCAAAGGCGGCATTTTTATAAAGTATTATAAAAATACAATCAAGGGGTCAACGAGAAGCTGAGAATCCCGAAAACAACAAACATCACATAATAACATCT
CGCACATTGGATTCACACCATCTCTCCTAAGTTAAGTTAACGAGAGCAGGGATCTATTTTTAGGCCAGAAATACTCTTTGATAGCGTCCACCACCTTGTTAACCTAGTGAGACATTACTT
TTAGTGACTAACCTGTTACTTTTTAGTGACCCACTTTTTTACTTAGTGACAGGCTTTTTTACTTGGTTAATGACTACTGATTTTAACTTTAGTGACACTATATTTGAGACAAAGAAAATA
AGTGTTATTGTTACTATTGTTTAGGAGGACATACACTTGGGTTCTCTCATTGCTCATCCTTCCAGAACCGGATACACAACTTTAACTCAAAGCAAAGTGTCGACCCAGCATTACAGTCGT
CATTTGCAGCCCGTTTAAAGAGCATATGCCCGGCACACAACACAGTAAAAAAGGCGGGTGCAAATCTTGATTCGACTCCCACAACTTTCGACAATAGATATTATAAGTTACTTCTACAAG
GCAAGAGTATTTTCTCATCTGATCAAGCATTGGTCACTATGGCAAACACCAAAACATTGGTCTCAAAGTTTGCTAGCTCACAACATGAGTTTGAGAAAGCATTTGTGAAATCCATGATTA
AGATGAGCAGCATCCATGGTGGCCAAGAGGTTAGGTTGGATTGTAGGGTGGTAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAACCTCTACATTGTCGTCTTCAATTCTTTTCATTACAAATAGCAACATTTCTCTCAATCATCTTCATCAAAACTTAAAGTTTCAAACACCACCAGAAAGTTCTTTGCTTCCAACA
ATGGCAGCCAAGAACACCACCATCTTTTCCTTTTTTTCAACTCTCATTTTCTTCGGTTTAATCCATTCTAATCAGATTGATGCGCTGAATACTAACTACTACGATCACACATGCCCCAAT
GTCGAATCAACCATTACAAGTGTTGTGAAGAAAGCTATGATGAATGATCCAACAGTTCCTGCTGCGCTTCTTAGAATGCATTTTCATGATTGCTTCATCAGG
GGCTGTGACGGTTCGGTG
TTGTTGAATTCAACTGGAAAGAACAAAGCTGAGAAAGATGGACCACCAAACATATCTTTGCATGCATTTTATGTAATTGATAATGCCAAGAAAGCACTAGAGTCTTTATGCCCCAAGACT
GTTTCTTGTGCAGATATTTTGGCATTAGCTGCAAGGGATGCAGTCACTTTG
TCCGGAGGGCCAACATGGGATGTTCCCAAAGGAAGAAAAGATGGAAGAATCTCAAAAGCAACCGAAACC
CGACAATTACCCGCTCCAACATTCAATATTTCTCAGCTTCAACAAAGTTTTGCTCAGAGAAGTCTTTCTATGGATGATTTAGTTGCACTCTCAG
GAGGACATACACTTGGGTTCTCTCAT
TGCTCATCCTTCCAGAACCGGATACACAACTTTAACTCAAAGCAAAGTGTCGACCCAGCATTACAGTCGTCATTTGCAGCCCGTTTAAAGAGCATATGCCCGGCACACAACACAGTAAAA
AAGGCGGGTGCAAATCTTGATTCGACTCCCACAACTTTCGACAATAGATATTATAAGTTACTTCTACAAGGCAAGAGTATTTTCTCATCTGATCAAGCATTGGTCACTATGGCAAACACC
AAAACATTGGTCTCAAAGTTTGCTAGCTCACAACATGAGTTTGAGAAAGCATTTGTGAAATCCATGATTAAGATGAGCAGCATCCATGGTGGCCAAGAGGTTAGGTTGGATTGTAGGGTG
GTAAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAACCT CTACATTGTC GTCTTCAATT CTTTTCATTA CAAATAGCAA CATTTCTCTC AATCATCTTC ATCAAAACTT AAAGTTTCAA ACACCACCAG AAAGTTCTTT GCTTCCAACA  ATGGCAGCCA AGAACACCAC CATCTTTTCC TTTTTTTCAA CTCTCATTTT CTTCGGTTTA ATCCATTCTA ATCAGATTGA TGCGCTGAAT ACTAACTACT ACGATCACAC ATGCCCCAAT  GTCGAATCAA CCATTACAAG TGTTGTGAAG AAAGCTATGA TGAATGATCC AACAGTTCCT GCTGCGCTTC TTAGAATGCA TTTTCATGAT TGCTTCATCA GGGGCTGTGA CGGTTCGGTG  TTGTTGAATT CAACTGGAAA GAACAAAGCT GAGAAAGATG GACCACCAAA CATATCTTTG CATGCATTTT ATGTAATTGA TAATGCCAAG AAAGCACTAG AGTCTTTATG CCCCAAGACT  GTTTCTTGTG CAGATATTTT GGCATTAGCT GCAAGGGATG CAGTCACTTT GTCCGGAGGG CCAACATGGG ATGTTCCCAA AGGAAGAAAA GATGGAAGAA TCTCAAAAGC AACCGAAACC  CGACAATTAC CCGCTCCAAC ATTCAATATT TCTCAGCTTC AACAAAGTTT TGCTCAGAGA AGTCTTTCTA TGGATGATTT AGTTGCACTC TCAGGAGGAC ATACACTTGG GTTCTCTCAT  TGCTCATCCT TCCAGAACCG GATACACAAC TTTAACTCAA AGCAAAGTGT CGACCCAGCA TTACAGTCGT CATTTGCAGC CCGTTTAAAG AGCATATGCC CGGCACACAA CACAGTAAAA  AAGGCGGGTG CAAATCTTGA TTCGACTCCC ACAACTTTCG ACAATAGATA TTATAAGTTA CTTCTACAAG GCAAGAGTAT TTTCTCATCT GATCAAGCAT TGGTCACTAT GGCAAACACC  AAAACATTGG TCTCAAAGTT TGCTAGCTCA CAACATGAGT TTGAGAAAGC ATTTGTGAAA TCCATGATTA AGATGAGCAG CATCCATGGT GGCCAAGAGG TTAGGTTGGA TTGTAGGGTG  GTAAACTAAA CCAAATTGGT GGAAATGGAA GGGACTGGCT TGACCCAATG TGTTCTTGAA TGAAATTGTA TAACATTTTT TATTTGTATT CCATTGGATG CTCAAAGTGT ATTGCTACAG 
AAGTTAGTAA CGTTTTGTGT TGTATTTTGA TTTTTGGGTG AAAATATCAT CTTTAAGTTT TTTTT 

Retrieve as FASTA