Entry information : HaPrx53 (HanXRQChr05g0162331)
Entry ID 13607
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx53 (HanXRQChr05g0162331)
Name (synonym) HaPrx53 (HanXRQChr05g0162331)
Class Class III peroxidase    [Orthogroup: Prx225]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx53
start..stop
S start..stop
HaPrx32 709 0 1..358 1..359
HaPrx69 591 0 1..358 1..362
LsaPrx24 506 0 8..306 1..298
FvPrx01 478 2e-170 31..349 28..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 214346938..214347195 258 N° 2 214344705..214344902 198 N° 3 214343656..214344276 621  
complement(join(214343656..214344276,214344705..214344902,214346938..214347195))


exon

Literature and cross-references HaPrx53 (HanXRQChr05g0162331)
DNA ref. HanXRQ genome:   HanXRQChr05 (214347195..214343656)
Protein sequence: HaPrx53 (HanXRQChr05g0162331)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   358 (326)
PWM (Da):   %s   38943.96 (35644.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.21 (8.21) Peptide Signal:   %s   cut: 33 range:33-358
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGKITVMPFHTVAVSVGVLVVMALHLQGLEAQQQPLVKGLSWKYYESSCPKLESIIRKQMEKVIKKDVGLAAALLRVHFHDCFVQGCDGSVLLDGSASGPVDSEKTAPPNLSLRGFDVIEDLRRRVHKQCGARSVSCSDITAIVARDAIVLTGGPDYSVPLGRRDGLSFATRNATLANLPSPFVGTDSLLTSLAAKNFDATDVVALSGAHTIGVAHCPSFTRRLYPTQDATMDKTLANTLKGVCPTQNTNATTFLDLRSPNVFDNKYFVDLMNKQGILTSDQDLYTDKRTREIVKSFAVNQTLFFEKFVNVMVKMGQMQVLTGTKGEIRNTCNKRNSNELVISNIVEDHNTDGVENL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGGTAAAATTACAGTAATGCCCTTTCACACAGTTGCAGTGAGTGTGGGTGTGTTGGTGGTGATGGCACTGCATTTGCAGGGTTTAGAAGCACAACAACAGCCATTGGTGAAGGGG
CTTTCTTGGAAATACTATGAAAGTAGCTGTCCAAAATTGGAATCAATAATTAGGAAGCAAATGGAGAAGGTGATCAAGAAGGATGTTGGTCTTGCTGCTGCTCTCTTGAGAGTTCATTTT
CATGATTGTTTTGTTCAG
GTATAAATTAACCTTTAACTTTTAATATTTTACAATTTAAATAAAGGTCACTGAATCTTTTAAAGCCAAGTTTAAAGTTTAGTCGCTGTGGTTTGGACCATT
TTGCCAGTTTAATCTAAAGGTTTCATTCTTCGTCTGTGGGTCTGTCATTTTAATCCACTGGTTAACTTCATCCATTTTTTCTGTTAACAAGAAGGGCAATTCGGTCATTTTATATGTAAT
TCTGTTAACTAGAAGAGCAATTCGGCCATACAAAATGACCGAATTGTCTTTCTCGATAACAGAAAAAATGGATGAAGTTAACCCAGTGGACTAAAATGGTAACGGTGAAAACTTTTTGGA
CTCGCAAACGAAAAATGAAACCTTTGGACTAAACTGGCAAAATGGACCAAACCACAGGGATTAAAATGACATTTAACTCGAAATACAAAGTCTCCTAAAAATAATAAGTTGTAAAAAGGG
TATCAAATGGACTCTGATTGACTTCATCCAAGCAGCATGGAACCGTCTCATCAAACTCTACGATATGAGATTTTAGGTTTTCACTTTAGGATTTATAGTTTGCAGATTTTAGAATATTTG
TTTATGTTACTGTGTCTTTTCTATATTTGCGTCATTGTGTCTTTTTTTCTCGACATTATATTATATTTTGCTCGATGTTATCTTATATTTTAAGATCGTGTCTCTGTATACTTCTTAGAT
TAAAAGACTTTATAGAATAATTTTATTTTACCCAATAAGATATATATCTGATAAAAGTTAATTTGTCACACACTTTCGAGTACAAAAATAATCAAACGTGTTGGTATACTTTTTATCTTT
AAAAGCACGTTGATGTAAAAGTAAATCTAAACTTTAATGATAACTCATGAACAAAAACGGGTCACCTTTGTAAGTGGAAATAATAGTAAGTTGGCCGATGACTCATTACACATTACACAT
GTTGATATAATATTTTTAATAATTAATAATTGATTTCCGCGTATTTGGGGTGTAGAAGAGTTGATTTGTTCGTGAGCTACTCGAGATTGAATCACTAAAAACACGAAAGGACCCGAGCTA
AAACGAGCTTGGGCCTAAATAAAAGTTTACTTATTAAATGAGCCTAGATTTTTCGTCTAGGCTTAACTAAGCTCGCAAACCTATTATTTATAAAAAAAAATACAAAATTCTAGTTTTTAT
ATAATAAATATTATTATAAACAAATTATGATAATTTAACTAAATAACATATACTGTGTATTATATACAAAGTAACTATTATAAATATATATATAAAAATAACTAGATATTTTTTTTTTGA
TAGAGAATTTTTTTTTTACGGTTTCAATATTATTTACTAGATATTTATAATGAATAAAATAATAAATGAGTCGAGCTCTAGCTTAGAAAAAATAACGAAACAAGCTCGCTCTTTAGACAT
AGAGCTTGAAGCTTACCAATCTCCCATAGACTCACAAACTAAGCTTGAATTTAAGCGGGTTCGGGCTCATTTCAGCTCGACTCATTGATACCCTTATTCCCTTATTCCCTTAAGACCATC
GCATCTCATCATCAAGTATATATATAATGAAATGTGGGGTTTTTCTTTTGCTTAACATAATGACTAAAGGTTCCTAAGAAGGCATCCCGATAGTTAAGTAATGTACTTCACAATTAAAGG
TTGAGAGTTTAAATGCAGGTGTGGTGAATCTATACTCGAAAATGTTGTTCAATAAACCCTTGATGATTAAAGGATAAATCAAACCCCCTTTTTTGGAAGGCAAAATTCTATTGAAACTCT
AGCGAGGCGCTAGAACAAAACACATACAACCAGAGATTAGGCTCTTGTTCTCCTTCAAGCGTAATATGATTTTAATGAAACCTAAATGTTTTTGGATTTTATAAAACGATTTTAGGGGAT
GATATTGTAATATGTTACTAATTAAGGAAACCTGGAAACAGGAACTATTCCTAAGGCTCGACGCAAATTGTTATATTAGTATAATGTTTATTTTCGTAGATTTGATGTTAGTTTAATTGT
TAACATTTAACAGGGCTGTGATGGTTCGGTTTTGTTGGATGGATCAGCAAGCGGACCAGTTGATAGCGAGAAAACGGCACCACCAAACCTAAGTTTAAGGGGTTTTGATGTCATTGAGGA
TCTTCGTCGTAGAGTTCACAAACAATGTGGTGCGCGTAGTGTCTCGTGTTCTGATATTACTGCTATAGTTGCGCGCGACGCTATTGTCTTG
GTAAATCCTCTTATACATCTTTCTTCAAT
GTTTTTTATAAACGGATTGGCCGTCAAATCATCTGTTTACTAGTTCACTGGTCATACCAGTCTTAAAAACCAGATGATGTTATAAACATTTTTAAATTAAATACACACGTATTAACTATA
TGAAACTACTTTATAATTTTGTAAGTTAGAATATAAACAAAACACGAAGTTTGAAGTTGTAAATGAATCGGTAAATGAGTTCTAAAAGATTTTTTTTATTCAGTCCAGTTCGTTGGTACA
TCCGGTGCAAATGCACTCAACTGAATCGGTTATGTAATGGTTTTTGTTCTGACCGATCGGTCCAAGTTTGAAAACTTTTTTTTTTTCATAGATTTAAAACTTACTTACATGTTTATGTAC
ATTAACATGTATTTGTATGTTATGTTGTACTTTTATTAGACCGGTGGTCCAGACTATAGCGTTCCTCTGGGTCGAAGAGATGGACTCTCATTCGCCACAAGAAACGCAACACTTGCCAAT
CTTCCATCACCGTTTGTCGGGACAGACTCGCTACTAACCTCCCTTGCCGCCAAAAACTTTGACGCCACCGATGTTGTAGCCCTATCAGGGGCCCACACCATCGGTGTCGCCCATTGCCCA
TCCTTCACGCGACGACTTTACCCTACACAAGATGCGACCATGGATAAAACCCTAGCCAACACCCTCAAAGGCGTTTGCCCAACCCAAAACACGAATGCCACAACTTTCTTGGACCTTCGG
TCTCCAAACGTGTTCGATAACAAGTACTTTGTCGATCTAATGAACAAACAAGGAATCCTAACATCTGACCAAGATCTTTACACCGACAAACGAACCCGAGAGATTGTCAAGAGCTTCGCA
GTCAACCAAACATTATTTTTCGAGAAATTCGTCAACGTCATGGTGAAGATGGGCCAAATGCAGGTTTTGACCGGCACAAAAGGTGAAATCCGCAACACTTGCAATAAGCGAAACTCAAAC
GAATTAGTCATATCAAACATTGTCGAGGACCACAACACGGACGGTGTCGAGAACCTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGGTAAAATTACAGTAATGCCCTTTCACACAGTTGCAGTGAGTGTGGGTGTGTTGGTGGTGATGGCACTGCATTTGCAGGGTTTAGAAGCACAACAACAGCCATTGGTGAAGGGG
CTTTCTTGGAAATACTATGAAAGTAGCTGTCCAAAATTGGAATCAATAATTAGGAAGCAAATGGAGAAGGTGATCAAGAAGGATGTTGGTCTTGCTGCTGCTCTCTTGAGAGTTCATTTT
CATGATTGTTTTGTTCAG
GGCTGTGATGGTTCGGTTTTGTTGGATGGATCAGCAAGCGGACCAGTTGATAGCGAGAAAACGGCACCACCAAACCTAAGTTTAAGGGGTTTTGATGTCATT
GAGGATCTTCGTCGTAGAGTTCACAAACAATGTGGTGCGCGTAGTGTCTCGTGTTCTGATATTACTGCTATAGTTGCGCGCGACGCTATTGTCTTG
ACCGGTGGTCCAGACTATAGCGTT
CCTCTGGGTCGAAGAGATGGACTCTCATTCGCCACAAGAAACGCAACACTTGCCAATCTTCCATCACCGTTTGTCGGGACAGACTCGCTACTAACCTCCCTTGCCGCCAAAAACTTTGAC
GCCACCGATGTTGTAGCCCTATCAGGGGCCCACACCATCGGTGTCGCCCATTGCCCATCCTTCACGCGACGACTTTACCCTACACAAGATGCGACCATGGATAAAACCCTAGCCAACACC
CTCAAAGGCGTTTGCCCAACCCAAAACACGAATGCCACAACTTTCTTGGACCTTCGGTCTCCAAACGTGTTCGATAACAAGTACTTTGTCGATCTAATGAACAAACAAGGAATCCTAACA
TCTGACCAAGATCTTTACACCGACAAACGAACCCGAGAGATTGTCAAGAGCTTCGCAGTCAACCAAACATTATTTTTCGAGAAATTCGTCAACGTCATGGTGAAGATGGGCCAAATGCAG
GTTTTGACCGGCACAAAAGGTGAAATCCGCAACACTTGCAATAAGCGAAACTCAAACGAATTAGTCATATCAAACATTGTCGAGGACCACAACACGGACGGTGTCGAGAACCTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTCACCTCAG CTATAAATAA ATGACCCATC TCTTTTGTAG TCTGTCTCAT CAAAAAGCAT AGTAACCAAC AAATAACAAT GGCTGGTAAA ATTACAGTAA TGCCCTTTCA CACAGTTGCA  GTGAGTGTGG GTGTGTTGGT GGTGATGGCA CTGCATTTGC AGGGTTTAGA AGCACAACAA CAGCCATTGG TGAAGGGGCT TTCTTGGAAA TACTATGAAA GTAGCTGTCC AAAATTGGAA  TCAATAATTA GGAAGCAAAT GGAGAAGGTG ATCAAGAAGG ATGTTGGTCT TGCTGCTGCT CTCTTGAGAG TTCATTTTCA TGATTGTTTT GTTCAGGGCT GTGATGGTTC GGTTTTGTTG  GATGGATCAG CAAGCGGACC AGTTGATAGC GAGAAAACGG CACCACCAAA CCTAAGTTTA AGGGGTTTTG ATGTCATTGA GGATCTTCGT CGTAGAGTTC ACAAACAATG TGGTGCGCGT  AGTGTCTCGT GTTCTGATAT TACTGCTATA GTTGCGCGCG ACGCTATTGT CTTGACCGGT GGTCCAGACT ATAGCGTTCC TCTGGGTCGA AGAGATGGAC TCTCATTCGC CACAAGAAAC  GCAACACTTG CCAATCTTCC ATCACCGTTT GTCGGGACAG ACTCGCTACT AACCTCCCTT GCCGCCAAAA ACTTTGACGC CACCGATGTT GTAGCCCTAT CAGGGGCCCA CACCATCGGT  GTCGCCCATT GCCCATCCTT CACGCGACGA CTTTACCCTA CACAAGATGC GACCATGGAT AAAACCCTAG CCAACACCCT CAAAGGCGTT TGCCCAACCC AAAACACGAA TGCCACAACT  TTCTTGGACC TTCGGTCTCC AAACGTGTTC GATAACAAGT ACTTTGTCGA TCTAATGAAC AAACAAGGAA TCCTAACATC TGACCAAGAT CTTTACACCG ACAAACGAAC CCGAGAGATT  GTCAAGAGCT TCGCAGTCAA CCAAACATTA TTTTTCGAGA AATTCGTCAA CGTCATGGTG AAGATGGGCC AAATGCAGGT TTTGACCGGC ACAAAAGGTG AAATCCGCAA CACTTGCAAT  AAGCGAAACT CAAACGAATT AGTCATATCA AACATTGTCG AGGACCACAA CACGGACGGT GTCGAGAACC TCTAAGCTAG TTAGGAACTT AGGATGTTAT CCTTTCATGT TTGTGCTATA  ATGTATGTCA GTATGTGCAC TTTGCTTTGT GTAACTCTGT TGTTGAGCAA TAAAGATGAA TTCTAAAACA AAATATATAA TCATATATGA GCAAATTATT GTAAATTTGT AATGTAACTG  TCTCATGCAA AAACATAATT ACAAATCTCT CAAAATTATT ATATTCATAA ACCAAATTAT AAATTATAAA CTCATGAATA TCAAATTCGA ATTCGATATC GAAAATTTCG ATCATACTGC  AAGTGAAAGA TCTCCAATTT CAAGCTGTGT AGCAATTTCT TCCAACTGCT TCTTCACACT CATATCAATC AATTTAGATC CAGAATTTCC ATACCTGATT GTAAAACCGG CAACTAACGA  CTCATCAATA ACCGTTTTCA CTCGCACATT CTTCGCTCCG GTGAGTTTCT GCACCTGTTT TGCAATCTGA GCCAGATGCT GTTCTTCAAG CTTCACAACC GACGATACAA CAGCAAGTTC  AGTTTCAGTT AATTTGTTGT AAACAAGTTC AAACTCCTTA ACAATCTCCT TAATCAGATC TATCCGTTTG CTCTCGATTA ATATGTTGAG GAAGTTGCAG ACGTGAATCT GAAGCTTACC  TGACGCGGTG ACGTCATCGA TGAGTGCGCG TTTCTGTTCG AGGCTTACGA TAGGGCTAGT GAAGTAGTTG AAGTTTGTTG AATCGGAAAA CAGTTTATCG ACCAGATCTA GGTCTTTGAC  AGTCGCTTCT AGCGTTCCGT TTGCAACGGC TACTTCTGCT AGTGCTGCGG CGTAGCTTCC GGCGGCGGAA TCCGCCATTT TTGCGCTCGA AGCGCCTCCG CCGCGGCGTG AGGTTCCGGC  GAGCTTGATT GAGAGGTTTT GGAGACGTAA ACCACCGGAA AACGAGAGTT TTTCTGGATT GACGAAGGTT ATACGGAGTG ACGGAGTGCG TTGGAATGTG ATCGGAGTTT GTTGAAGAGC 
GGCGGTGGTG GCG 

Retrieve as FASTA