Entry information : HaPrx54 (HanXRQChr06g0177981)
Entry ID 13608
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx54 (HanXRQChr06g0177981)
Name (synonym) HaPrx54 (HanXRQChr06g0177981)
Class Class III peroxidase    [Orthogroup: Prx162]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx54
start..stop
S start..stop
HaPrx133 598 0 22..322 164..464
SsqPrx01_OS-Bill4 466 4e-167 1..322 1..326
SsqPrx01_A34-4-23 466 5e-167 1..322 1..326
SsqPrx01_Ox15 466 6e-167 1..322 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45891449..45891835 387 N° 2 45890137..45890299 163 N° 3 45889635..45890053 419  
complement(join(45889635..45890053,45890137..45890299,45891449..45891835))


exon

Literature and cross-references HaPrx54 (HanXRQChr06g0177981)
DNA ref. HanXRQ genome:   HanXRQChr06 (45891835..45889635)
Protein sequence: HaPrx54 (HanXRQChr06g0177981)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (299)
PWM (Da):   %s   34976.72 (32410.2)  
PI (pH):   %s   8.73 (8.39) Peptide Signal:   %s   cut: 24 range:24-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGLYSHIKLPLFVLLLATLTVRSTRVGFYKTTCPQAEAIVQSVVQSAIRSNQTYAPGILQMFFHDCFVNGCDASVLIDGSFSEKTARTNSRLRGYEVIDAAKSMLENVCPGVVSCADILALAARDSVVQTGGSGWAVPTGRRDGLVSLASDAESMPGPKDSIDDQIKKFANKGLSIKDLVTLVGGHTIGTAGCDTFSDRLYNYNNTNAPDPAIDQGFLPHLQTLCPLSGDLTRRVALDTNSENNFDNSFYENIRRGRGVLESDSKLWSDPRTQKLAQRFIGASRSHGSTFNKMFARAMVKMSKIELKTGNQGEIRRVCNKIN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGACTTTATTCTCATATCAAACTACCCTTGTTTGTTCTCCTTTTAGCCACCTTGACAGTACGCTCCACACGAGTCGGGTTCTACAAGACTACATGCCCACAAGCTGAAGCCATCGTG
CAGTCTGTGGTCCAGTCTGCGATTCGATCAAACCAGACATATGCACCTGGTATACTACAAATGTTCTTTCACGATTGCTTTGTCAATGGTTGTGATGCATCCGTCTTAATTGATGGCTCT
TTTTCTGAGAAAACCGCAAGAACAAATTCTCGCTTGAGAGGCTATGAAGTCATAGATGCTGCAAAGTCCATGCTAGAAAACGTCTGTCCGGGGGTGGTCTCCTGTGCAGACATTCTTGCC
CTCGCTGCTCGTGATTCTGTGGTCCAG
GTAGTTAATCACTAGCTTCATACATGTTTAACTTAAGCATTACACGGATGTTAGAAAATCTATTTAAATCTGTAGTTTTTCTCCTTTCGTATT
GTTTGTCATCAGTTTTTGTTATTGACGGTTTAGTATTATTAATATTAGAGCATCCACAATAGGATGCTTTTGCTCGCTTTTAGCCTCCAAAAACGCCACATATCAGGTTTAACCATTGTG
GAGCTCGCTTTGGCATCCATTTTTGGGTTGTAGACATGTAGTTCTTGGTAATAAACAAGAAAAAACGCATTTGAGTTAGGGCCAATCATTTAATATATAGAGAAATGAGTAGTTAAAAAT
AAAAAAAGACATGGTGATGATGTGTTAATGTTTTTGAGTGTTTTTAGGTTTTCTTATTGGGTGTGTTTTAGGCAATGTTAGATTGTAGTTCTTAAATATCTTAATATCCTTATCAGAGAA
ATTACATAACAATGACAGGTAAACCGGCAACAAGCTACGTCACCACCCTCTTTTGAATAGCAAAGCCAAATCCAATTGTACCAAAAACAAAATTCTGGTTCTTTAGTGCTTTTGAAAGAG
TGCTTTTTTGACGTGACAACTGAGTAGACATGTTTTTTAGTATTTTTAGATATCCTTATTAGGGGAGGGGACACTTAAACCCCTACCCTAAGTCCCGCTAATCTCGTCGTGACACGTCAC
TCAGACCATCCACTATCCTAAACTACCTTCTTTGGTGGCGCCACTACCCTAAGACCTAAACTGCCCTCTCTTTTTTATTTTAATTATACATACATACACACACAATCATCAATTTCAAGC
GGCAACATGTTAACCCCACCCTACTCACCCGTCCCTACCTGTTGGACCGACGACAGTGTTTGGGAGCGGGTAGGGGGCACCCGCCAGCCTTACCCTTACCGCTGGTTCCCCTCCTCCCCT
TAGGGATGGTCTTAGAATTTTTGTTTTTCTTGTCCACACTTTATGTTATTTGTTTTGTCATACTTTATTTTTCTGAAAAAGAGGGTTATTTTTTTGTGGGCTGGGATCATGTTGGGTGTT
GCATCTCGGTATCATGGTGTACATGAAAGTTTTGCCCTCATTAATTTCTTACTATGAGTAGAATCTTACTGAGTACGTTTATTTGTATTGTTTTAGACTGGGGGAAGTGGTTGGGCAGTG
CCAACAGGTCGTCGAGACGGATTAGTTTCACTGGCATCTGATGCCGAAAGCATGCCTGGTCCTAAAGACTCCATTGATGACCAAATCAAGAAGTTTGCTAACAAAGGTCTTAGCATTAAA
GATCTGGTTACCCTTGTAG
GTAAGTTAAGACCAACAAATTAACATTGGAATGGATATAGTTTCAAAGGAACTAACTTGCATATTTTACGGTTTAATTCAAAGGAGGACATACGATTGGGA
CAGCTGGCTGTGACACATTCAGTGACAGGCTATACAACTACAACAATACTAATGCACCCGACCCTGCTATTGACCAAGGATTCCTTCCCCATCTTCAAACCCTATGTCCTCTTAGCGGTG
ATCTTACAAGGCGAGTGGCCTTGGATACAAACAGCGAAAACAATTTCGACAACTCATTCTATGAAAACATAAGGCGTGGACGAGGAGTACTTGAATCCGATTCAAAGCTGTGGAGTGACC
CACGAACACAAAAGTTGGCGCAACGGTTTATTGGAGCTAGCAGATCGCATGGATCAACATTCAACAAGATGTTCGCGAGAGCAATGGTGAAGATGAGTAAAATTGAGTTAAAGACAGGTA
ATCAAGGAGAAATTCGTAGGGTTTGTAACAAGATCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGACTTTATTCTCATATCAAACTACCCTTGTTTGTTCTCCTTTTAGCCACCTTGACAGTACGCTCCACACGAGTCGGGTTCTACAAGACTACATGCCCACAAGCTGAAGCCATCGTG
CAGTCTGTGGTCCAGTCTGCGATTCGATCAAACCAGACATATGCACCTGGTATACTACAAATGTTCTTTCACGATTGCTTTGTCAATGGTTGTGATGCATCCGTCTTAATTGATGGCTCT
TTTTCTGAGAAAACCGCAAGAACAAATTCTCGCTTGAGAGGCTATGAAGTCATAGATGCTGCAAAGTCCATGCTAGAAAACGTCTGTCCGGGGGTGGTCTCCTGTGCAGACATTCTTGCC
CTCGCTGCTCGTGATTCTGTGGTCCAG
ACTGGGGGAAGTGGTTGGGCAGTGCCAACAGGTCGTCGAGACGGATTAGTTTCACTGGCATCTGATGCCGAAAGCATGCCTGGTCCTAAAGAC
TCCATTGATGACCAAATCAAGAAGTTTGCTAACAAAGGTCTTAGCATTAAAGATCTGGTTACCCTTGTAG
GAGGACATACGATTGGGACAGCTGGCTGTGACACATTCAGTGACAGGCTA
TACAACTACAACAATACTAATGCACCCGACCCTGCTATTGACCAAGGATTCCTTCCCCATCTTCAAACCCTATGTCCTCTTAGCGGTGATCTTACAAGGCGAGTGGCCTTGGATACAAAC
AGCGAAAACAATTTCGACAACTCATTCTATGAAAACATAAGGCGTGGACGAGGAGTACTTGAATCCGATTCAAAGCTGTGGAGTGACCCACGAACACAAAAGTTGGCGCAACGGTTTATT
GGAGCTAGCAGATCGCATGGATCAACATTCAACAAGATGTTCGCGAGAGCAATGGTGAAGATGAGTAAAATTGAGTTAAAGACAGGTAATCAAGGAGAAATTCGTAGGGTTTGTAACAAG
ATCAATTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCCTACAAT ACATTTGAAG CAATGGGACT TTATTCTCAT ATCAAACTAC CCTTGTTTGT TCTCCTTTTA GCCACCTTGA CAGTACGCTC CACACGAGTC GGGTTCTACA AGACTACATG  CCCACAAGCT GAAGCCATCG TGCAGTCTGT GGTCCAGTCT GCGATTCGAT CAAACCAGAC ATATGCACCT GGTATACTAC AAATGTTCTT TCACGATTGC TTTGTCAATG GTTGTGATGC  ATCCGTCTTA ATTGATGGCT CTTTTTCTGA GAAAACCGCA AGAACAAATT CTCGCTTGAG AGGCTATGAA GTCATAGATG CTGCAAAGTC CATGCTAGAA AACGTCTGTC CGGGGGTGGT  CTCCTGTGCA GACATTCTTG CCCTCGCTGC TCGTGATTCT GTGGTCCAGA CTGGGGGAAG TGGTTGGGCA GTGCCAACAG GTCGTCGAGA CGGATTAGTT TCACTGGCAT CTGATGCCGA  AAGCATGCCT GGTCCTAAAG ACTCCATTGA TGACCAAATC AAGAAGTTTG CTAACAAAGG TCTTAGCATT AAAGATCTGG TTACCCTTGT AGGAGGACAT ACGATTGGGA CAGCTGGCTG  TGACACATTC AGTGACAGGC TATACAACTA CAACAATACT AATGCACCCG ACCCTGCTAT TGACCAAGGA TTCCTTCCCC ATCTTCAAAC CCTATGTCCT CTTAGCGGTG ATCTTACAAG  GCGAGTGGCC TTGGATACAA ACAGCGAAAA CAATTTCGAC AACTCATTCT ATGAAAACAT AAGGCGTGGA CGAGGAGTAC TTGAATCCGA TTCAAAGCTG TGGAGTGACC CACGAACACA  AAAGTTGGCG CAACGGTTTA TTGGAGCTAG CAGATCGCAT GGATCAACAT TCAACAAGAT GTTCGCGAGA GCAATGGTGA AGATGAGTAA AATTGAGTTA AAGACAGGTA ATCAAGGAGA  AATTCGTAGG GTTTGTAACA AGATCAATTA ATTAACTGAT GATGATGGGT GTCCGGTAGG CGGTAGGCTG ATTGAATAAA CGTATTCCAA CATCAAGAAG GCCTAAGCTA AGCTAGTCTG  GCCGTATATA TCATATCACT ATTACATTAG TTGGTAAAAT AATAGTTTAT TCAATATCAC TGTACAAGAA TGATGTATTA GCTACCTAAA GGAGAACTTA AAAAGTGATA TTTACTATTT 
AGTTATTGAG GCTTTTCTGA CTCAAGAACC TACACTATTA TGCTATTCGC GTTGATGGAA CAAATAATTG GTAAAAACTT GTTGAAAAAA ATATAAATGA AG 

Retrieve as FASTA