Entry information : HaPrx56 (HanXRQChr07g0190001)
Entry ID 13610
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx56 (HanXRQChr07g0190001)
Name (synonym) HaPrx56 (HanXRQChr07g0190001)
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx56
start..stop
S start..stop
HaPrx36 604 0 1..329 1..327
LvPrx15 586 0 1..329 1..328
AanPrx01 580 0 1..329 1..328
LsaPrx15 553 0 1..329 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25338823..25339239 417 N° 2 25338569..25338734 166 N° 3 25337749..25338155 407  
complement(join(25337749..25338155,25338569..25338734,25338823..25339239))


exon

Literature and cross-references HaPrx56 (HanXRQChr07g0190001)
DNA ref. HanXRQ genome:   HanXRQChr07 (25339239..25337749)
Protein sequence: HaPrx56 (HanXRQChr07g0190001)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   35344.72 (32723.2)  
PI (pH):   %s   8.56 (8.39) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRVTIIQVLALSSLLIIFPNLASAQLKQNYYANVCPNVETIVRNAVQAKVRQTFITIPGTLRLFFHDCFVQGCDASVMIASSGSNTAEKDHPDNLSLAGDGFDTVIKAKAAVDAVPSCRNKVSCADILVMATRDVVVMAGGPSYAVELGRFDGLSSTAASVGGKLPKPNMNLDQLNAMFAANGLTQVDMIALSGAHTVGFSHCDQFTNRIYNFSKQSLVDPTLNPTYAAQLQQQCPKNVDPQIAINMDPNTPNTFDNMYFKNLQQGKGLFTSDQVLFTDSRSKQTVDSWASSTKAFNNAFVAAMTKLGRVGVKNAKNGNIRRDCSAFN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCGGGTCACTATTATTCAAGTATTAGCTCTCTCTTCACTTCTCATCATCTTCCCAAACTTGGCTTCTGCTCAACTCAAGCAAAACTACTACGCAAACGTTTGCCCGAATGTAGAA
ACAATCGTTCGCAACGCAGTCCAGGCTAAGGTTCGACAGACATTTATTACAATCCCAGGAACTCTTCGTTTGTTCTTCCATGATTGTTTCGTTCAAGGGTGTGACGCTTCGGTTATGATA
GCATCCAGCGGGTCCAACACTGCGGAAAAAGACCATCCGGATAACCTGTCGTTGGCTGGAGACGGGTTTGATACGGTTATTAAAGCTAAAGCGGCGGTTGATGCTGTCCCGAGTTGCAGA
AATAAGGTTTCGTGTGCGGATATTCTTGTCATGGCTACGCGTGATGTTGTTGTGATG
GTATTATTGATTTTGTTTCATGTAGGTTTTTAGATGTTTATAGTAGTTAGTTTGGATATTGAT
TGTTAATAATTGGTGGTGGTTGCAGGCGGGGGGACCGTCGTATGCGGTGGAGCTCGGGAGGTTTGACGGGTTGAGTTCGACAGCGGCTAGTGTGGGTGGGAAGTTGCCTAAACCAAACAT
GAATTTGGATCAGCTTAACGCCATGTTTGCGGCTAACGGGTTGACCCAAGTCGACATGATTGCTCTCTCAG
GTAAAAAGGTGTTGATTTCAACGCGTTTATAATGGGTCGATTCAGGACC
TTATGCTATCACTGTTGTGTCTAAATAGGTAGATGGGTCGGGTCAAACGGACCGGATGTCGGTCATACATATTTTTAACACAAAACCTCCTAAATTACATTCCTTTTGCAATTGTACTCA
ACTAGCGGGTGAAACTCACGCTTTGCGTCAGAGATGTAAAAATTTATATGGCTCGATTACAACGACTAAAAAAAGTTTATTTACATATTGCAAAAAAGTTGTATGGTGTAACCCAAAAAG
TAAAGTCGTGTTTTATATAGATCGAAAACCATAAAAACGAATATCGATACCGGTACCGATGTCGCTTGGTCGGATGTCAGTCACATTTTTTAACAAAATATTCTCGGGTCAACCCATTAT
CTAGGTGCACACACGGTGGGATTCTCGCATTGCGACCAATTCACAAACAGGATATACAACTTCAGCAAGCAGAGCCTAGTGGACCCAACTCTAAACCCAACTTACGCAGCCCAATTGCAG
CAACAGTGTCCAAAAAACGTTGACCCACAGATAGCTATAAATATGGATCCAAACACGCCCAATACATTTGACAACATGTACTTCAAGAATTTGCAACAAGGAAAAGGATTGTTCACCTCT
GACCAGGTCCTCTTCACTGACTCAAGGTCGAAGCAGACGGTGGACTCGTGGGCCTCGAGCACGAAAGCTTTCAATAACGCATTTGTTGCAGCCATGACTAAACTGGGTCGGGTTGGGGTT
AAGAATGCCAAGAATGGGAATATCAGGCGAGATTGTTCTGCATTTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCGGGTCACTATTATTCAAGTATTAGCTCTCTCTTCACTTCTCATCATCTTCCCAAACTTGGCTTCTGCTCAACTCAAGCAAAACTACTACGCAAACGTTTGCCCGAATGTAGAA
ACAATCGTTCGCAACGCAGTCCAGGCTAAGGTTCGACAGACATTTATTACAATCCCAGGAACTCTTCGTTTGTTCTTCCATGATTGTTTCGTTCAAGGGTGTGACGCTTCGGTTATGATA
GCATCCAGCGGGTCCAACACTGCGGAAAAAGACCATCCGGATAACCTGTCGTTGGCTGGAGACGGGTTTGATACGGTTATTAAAGCTAAAGCGGCGGTTGATGCTGTCCCGAGTTGCAGA
AATAAGGTTTCGTGTGCGGATATTCTTGTCATGGCTACGCGTGATGTTGTTGTGATG
GCGGGGGGACCGTCGTATGCGGTGGAGCTCGGGAGGTTTGACGGGTTGAGTTCGACAGCGGCT
AGTGTGGGTGGGAAGTTGCCTAAACCAAACATGAATTTGGATCAGCTTAACGCCATGTTTGCGGCTAACGGGTTGACCCAAGTCGACATGATTGCTCTCTCAG
GTGCACACACGGTGGGA
TTCTCGCATTGCGACCAATTCACAAACAGGATATACAACTTCAGCAAGCAGAGCCTAGTGGACCCAACTCTAAACCCAACTTACGCAGCCCAATTGCAGCAACAGTGTCCAAAAAACGTT
GACCCACAGATAGCTATAAATATGGATCCAAACACGCCCAATACATTTGACAACATGTACTTCAAGAATTTGCAACAAGGAAAAGGATTGTTCACCTCTGACCAGGTCCTCTTCACTGAC
TCAAGGTCGAAGCAGACGGTGGACTCGTGGGCCTCGAGCACGAAAGCTTTCAATAACGCATTTGTTGCAGCCATGACTAAACTGGGTCGGGTTGGGGTTAAGAATGCCAAGAATGGGAAT
ATCAGGCGAGATTGTTCTGCATTTAATTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCTGGCTTTA TCTTTACCTG CCTTATTTAA CAAATCTTAC TACTAGCTAT CATCTTCCAA ACACATACAC ATACACCTTC ATCAACCATC ATGGGTCGGG TCACTATTAT TCAAGTATTA  GCTCTCTCTT CACTTCTCAT CATCTTCCCA AACTTGGCTT CTGCTCAACT CAAGCAAAAC TACTACGCAA ACGTTTGCCC GAATGTAGAA ACAATCGTTC GCAACGCAGT CCAGGCTAAG  GTTCGACAGA CATTTATTAC AATCCCAGGA ACTCTTCGTT TGTTCTTCCA TGATTGTTTC GTTCAAGGGT GTGACGCTTC GGTTATGATA GCATCCAGCG GGTCCAACAC TGCGGAAAAA  GACCATCCGG ATAACCTGTC GTTGGCTGGA GACGGGTTTG ATACGGTTAT TAAAGCTAAA GCGGCGGTTG ATGCTGTCCC GAGTTGCAGA AATAAGGTTT CGTGTGCGGA TATTCTTGTC  ATGGCTACGC GTGATGTTGT TGTGATGGCG GGGGGACCGT CGTATGCGGT GGAGCTCGGG AGGTTTGACG GGTTGAGTTC GACAGCGGCT AGTGTGGGTG GGAAGTTGCC TAAACCAAAC  ATGAATTTGG ATCAGCTTAA CGCCATGTTT GCGGCTAACG GGTTGACCCA AGTCGACATG ATTGCTCTCT CAGGTGCACA CACGGTGGGA TTCTCGCATT GCGACCAATT CACAAACAGG  ATATACAACT TCAGCAAGCA GAGCCTAGTG GACCCAACTC TAAACCCAAC TTACGCAGCC CAATTGCAGC AACAGTGTCC AAAAAACGTT GACCCACAGA TAGCTATAAA TATGGATCCA  AACACGCCCA ATACATTTGA CAACATGTAC TTCAAGAATT TGCAACAAGG AAAAGGATTG TTCACCTCTG ACCAGGTCCT CTTCACTGAC TCAAGGTCGA AGCAGACGGT GGACTCGTGG  GCCTCGAGCA CGAAAGCTTT CAATAACGCA TTTGTTGCAG CCATGACTAA ACTGGGTCGG GTTGGGGTTA AGAATGCCAA GAATGGGAAT ATCAGGCGAG ATTGTTCTGC ATTTAATTGA 
TGTTATACTC ATATATTACT AAGCTGATTG CATAAATTAA ACACTCTATT TACTTATTGC GGGAATACTT ACATGATTGA ATTTTATAAC ATTAGTTTAA AG 

Retrieve as FASTA