Entry information : HaPrx57 (HanXRQChr07g0196801)
Entry ID 13611
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx57 (HanXRQChr07g0196801)
Name (synonym) HaPrx57 (HanXRQChr07g0196801)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx57
start..stop
S start..stop
LperPrx22 551 0 1..322 1..322
LsaPrx22 548 0 1..328 1..327
LvPrx22-1 548 0 1..328 1..327
HaPrx58 538 0 1..328 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 68755668..68755880 213 N° 2 68755060..68755242 183 N° 3 68754818..68754983 166 N° 4 68754328..68754752 425
complement(join(68754328..68754752,68754818..68754983,68755060..68755242,6875566 8..68755880))


exon

Literature and cross-references HaPrx57 (HanXRQChr07g0196801)
DNA ref. HanXRQ genome:   HanXRQChr07 (68755880..68754328)
Protein sequence: HaPrx57 (HanXRQChr07g0196801)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (304)
PWM (Da):   %s   35316.44 (32630.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.34 (5.09) Peptide Signal:   %s   cut: 25 range:25-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTSNNISFAWFITISMLCLLANSQLTTNFYSQSCPKLQSIVRRQVTMALKTEMRMAASLLRLHFHDCFVNGCDASILLDGADGEKFALPNNNSARGYEVVDAIKTAVESSCSGVVSCADILTIAARDSVVLSGGTGWPVLLGRRDGFVANQSGANSNLPAPFENIGNITLKFEAVGLNLTDVVSLSGAHTIGQASCATFGNRLFNFSGTNAPDSTLLDQNMLTGLQNLCPVNGDSSRTSPLDWNSTDLFDNHYFQNLVKGRGVLESDQILYSSDEALTTTRSLVELYSNDKDAFANDFKNSMIKMGNIQPLTGSAGEIRRNCRVVNS

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCTCAAACAACATTAGTTTTGCATGGTTTATAACCATTTCAATGTTGTGTTTGCTTGCAAATTCTCAACTAACAACAAACTTCTACTCACAATCATGCCCTAAGCTTCAATCT
ATTGTAAGGAGACAAGTTACGATGGCGCTTAAAACCGAAATGAGAATGGCTGCTTCTTTGCTTAGGCTTCATTTCCATGATTGTTTTGTAAAT
GTAAGTCATGTTCTAACTTCTAATCAA
TATATATAAAGAGGGGGGGGGGGGGGGGTGTTAAAACACAAAGGGTTGTTAACGTGCGAAGAATTAATATACGTTGCGCAATTATATTACTTCATGCGTAATTATGATACTTTATGCATA
ATTATGATACTTCATGCACAATTATATTTACTTACATGCGTAATTAACTGCGTACGTTTCTCACGTTAACTCCACTTCAAGGGGGTGGCGCACTGTAAACGTCTGATTTCGTTTAGTAGA
GGCATCATGTTCAAAGCCAGTTTTAAGTGGTTTTCCGTTAACCCCTTGAAGCCCACCTGGCATCGCAAGTTGCGTTTTACATGGTCTCATTGGTTACGTATATGTAACGCTTAACTAAAC
ATGTTTTGCTTTAACATTTGCATTATATTAAGTAACAGGGTTGTGACGCGTCGATTTTACTTGATGGAGCTGATGGAGAGAAGTTTGCTTTACCAAACAATAACTCGGCTAGGGGATACG
AGGTGGTGGATGCGATTAAAACCGCCGTGGAAAGTTCATGCAGCGGAGTAGTTTCTTGTGCTGATATTCTGACCATAGCGGCTCGTGATTCAGTTGTCCTG
GTAAGCATGAAAACATCAT
TAAAAAAATATATGACTCTGAAAACCGACCCGAAAAGTAACCAGAATGGGTTTGCAGAGTGGAGGAACAGGTTGGCCAGTGTTACTAGGAAGACGAGACGGATTTGTAGCAAACCAATCC
GGGGCTAACTCAAATTTACCCGCACCCTTTGAGAACATTGGTAACATTACTCTCAAGTTTGAAGCCGTGGGCCTCAACCTCACAGACGTCGTGTCTCTTTCAG
GTATCTTAAGTTTCCGG
TTAAAGGGTTCTTAACGAAAAATGATCTAATGATATATAACTGTGTAGGTGCGCATACGATTGGGCAAGCAAGTTGCGCGACATTTGGAAACAGATTATTCAACTTCTCAGGAACGAATG
CTCCCGACAGTACGTTGCTTGACCAGAATATGCTAACGGGCCTACAGAATCTATGTCCAGTAAACGGAGATAGTAGCCGAACATCACCTCTTGACTGGAACTCGACGGACCTTTTTGACA
ACCATTACTTCCAAAACTTGGTCAAGGGGCGGGGAGTTCTTGAATCCGATCAAATCTTGTATTCGAGTGATGAGGCTTTGACAACTACGCGAAGTCTTGTTGAGCTCTACAGCAACGACA
AGGATGCTTTCGCCAATGATTTTAAAAATTCCATGATCAAAATGGGGAATATACAACCCCTCACAGGATCTGCTGGTGAGATTAGGAGGAATTGCAGGGTGGTTAATTCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCTCAAACAACATTAGTTTTGCATGGTTTATAACCATTTCAATGTTGTGTTTGCTTGCAAATTCTCAACTAACAACAAACTTCTACTCACAATCATGCCCTAAGCTTCAATCT
ATTGTAAGGAGACAAGTTACGATGGCGCTTAAAACCGAAATGAGAATGGCTGCTTCTTTGCTTAGGCTTCATTTCCATGATTGTTTTGTAAAT
GGTTGTGACGCGTCGATTTTACTTGAT
GGAGCTGATGGAGAGAAGTTTGCTTTACCAAACAATAACTCGGCTAGGGGATACGAGGTGGTGGATGCGATTAAAACCGCCGTGGAAAGTTCATGCAGCGGAGTAGTTTCTTGTGCTGAT
ATTCTGACCATAGCGGCTCGTGATTCAGTTGTCCTG
AGTGGAGGAACAGGTTGGCCAGTGTTACTAGGAAGACGAGACGGATTTGTAGCAAACCAATCCGGGGCTAACTCAAATTTACCC
GCACCCTTTGAGAACATTGGTAACATTACTCTCAAGTTTGAAGCCGTGGGCCTCAACCTCACAGACGTCGTGTCTCTTTCAG
GTGCGCATACGATTGGGCAAGCAAGTTGCGCGACATTT
GGAAACAGATTATTCAACTTCTCAGGAACGAATGCTCCCGACAGTACGTTGCTTGACCAGAATATGCTAACGGGCCTACAGAATCTATGTCCAGTAAACGGAGATAGTAGCCGAACATCA
CCTCTTGACTGGAACTCGACGGACCTTTTTGACAACCATTACTTCCAAAACTTGGTCAAGGGGCGGGGAGTTCTTGAATCCGATCAAATCTTGTATTCGAGTGATGAGGCTTTGACAACT
ACGCGAAGTCTTGTTGAGCTCTACAGCAACGACAAGGATGCTTTCGCCAATGATTTTAAAAATTCCATGATCAAAATGGGGAATATACAACCCCTCACAGGATCTGCTGGTGAGATTAGG
AGGAATTGCAGGGTGGTTAATTCATAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCATTTTAA GGAATTCTAT ATTCTCCAAC TATCATCTAT CATTGCCTAT AAATTAAGTT AATCTCCAGC TTACTTCACA CACCATTTTC TTTAAAGAAA ACATCACTTG TACCCATGAA  GACCTCAAAC AACATTAGTT TTGCATGGTT TATAACCATT TCAATGTTGT GTTTGCTTGC AAATTCTCAA CTAACAACAA ACTTCTACTC ACAATCATGC CCTAAGCTTC AATCTATTGT  AAGGAGACAA GTTACGATGG CGCTTAAAAC CGAAATGAGA ATGGCTGCTT CTTTGCTTAG GCTTCATTTC CATGATTGTT TTGTAAATGG TTGTGACGCG TCGATTTTAC TTGATGGAGC  TGATGGAGAG AAGTTTGCTT TACCAAACAA TAACTCGGCT AGGGGATACG AGGTGGTGGA TGCGATTAAA ACCGCCGTGG AAAGTTCATG CAGCGGAGTA GTTTCTTGTG CTGATATTCT  GACCATAGCG GCTCGTGATT CAGTTGTCCT GAGTGGAGGA ACAGGTTGGC CAGTGTTACT AGGAAGACGA GACGGATTTG TAGCAAACCA ATCCGGGGCT AACTCAAATT TACCCGCACC  CTTTGAGAAC ATTGGTAACA TTACTCTCAA GTTTGAAGCC GTGGGCCTCA ACCTCACAGA CGTCGTGTCT CTTTCAGGTG CGCATACGAT TGGGCAAGCA AGTTGCGCGA CATTTGGAAA  CAGATTATTC AACTTCTCAG GAACGAATGC TCCCGACAGT ACGTTGCTTG ACCAGAATAT GCTAACGGGC CTACAGAATC TATGTCCAGT AAACGGAGAT AGTAGCCGAA CATCACCTCT  TGACTGGAAC TCGACGGACC TTTTTGACAA CCATTACTTC CAAAACTTGG TCAAGGGGCG GGGAGTTCTT GAATCCGATC AAATCTTGTA TTCGAGTGAT GAGGCTTTGA CAACTACGCG  AAGTCTTGTT GAGCTCTACA GCAACGACAA GGATGCTTTC GCCAATGATT TTAAAAATTC CATGATCAAA ATGGGGAATA TACAACCCCT CACAGGATCT GCTGGTGAGA TTAGGAGGAA  TTGCAGGGTG GTTAATTCAT AAATTCGTCC GGTTTCAAGA TTATGTACAA GATTTAGTTA CATCCATATA ACTCTTAGGA TCTAAAATGA TAATTATGAA TAAATGAACT TGTGTTTTTT 
ATTAATCCAG TGGAAAAAAA AAAAACTATC CTTCTTGATT CCGTATTCAT ACGCGCGGTC ATTGTTGTAA AAATCC 

Retrieve as FASTA