Entry information : HaPrx58(HanXRQChr07g0196821 / HanXRQChr07g0196841)
Entry ID 13612
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2022-05-19 (Christophe Dunand)
Peroxidase information: HaPrx58(HanXRQChr07g0196821 / HanXRQChr07g0196841)
Name HaPrx58(HanXRQChr07g0196821 / HanXRQChr07g0196841)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx58
start..stop
S start..stop
HaPrx31 659 0 1..328 1..328
HaPrx57 538 0 1..328 1..328
LperPrx22 516 0 1..322 1..322
LvPrx22-1 514 0 1..328 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 68818932..68819144 213 N° 2 68818429..68818611 183 N° 3 68815411..68815576 166 N° 4 68814586..68815010 425
complement(join(68814586..68815010,68815411..68815576,68818429..68818611,6881893 2..68819144))


exon

Literature and cross-references HaPrx58(HanXRQChr07g0196821 / HanXRQChr07g0196841)
DNA ref. HanXRQ genome:   HanXRQChr07 (68819144..68814586)
Protein sequence: HaPrx58(HanXRQChr07g0196821 / HanXRQChr07g0196841)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (304)
PWM (Da):   %s   35828.03 (33127.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.34 (6.98) Peptide Signal:   %s   cut: 25 range:25-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTSNNINFAWFITISMLCLLATSQLTTDFYSKTCPNLRTIVRDQITKVIKTEPRMAASLLRLHFHDCFVNGCDASILLDGADGEKFALPNINSARGFELVDSIKSAVESSCSGVVSCADILAVAARYSVVFSGGRRYDVPLGRRDGLVANQTGANLMLPAPFETLGNITRKFEAVGLNITDVVILSGAHTFGKASCATFRNRLFNFSGTNAPDSTLLDSSMVSVLQNLCPVNGDGRQTTALDWNSTENFDNHYFRNLVNGRGLLESDQVLYSSDEAISTTRSLVELYSKNWQIFLDDFKHSMVKLGNIQPLTGSSGEIRKNCRVVNS

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTTCAAACAACATTAATTTTGCATGGTTTATAACCATCTCAATGCTGTGTTTGCTTGCAACTTCTCAACTAACAACTGATTTCTACTCAAAGACATGTCCTAATCTTCGCACC
ATTGTACGTGACCAAATTACTAAGGTGATTAAAACTGAACCAAGAATGGCAGCTTCTTTGCTTCGGCTACACTTCCATGATTGTTTTGTAAAT
GTAAGTCCTCCTCTAACTTCTAATCAA
TAATATATATAACCTTCAAGGGGGCGGCGTTGTGGTAATTCCCTTTAGTGGAGGTTTCAAGTTTAAATGCAGCTTTAATTGGGTTTTTTTTAACCTCTTGAAGGTCACCTGCCCATCACA
AGTTGCGTTTAACATGTTCTCATTGGTTAGCAGGGCATTGGTGGACACTAAGTTTTTGTTCTCACGGTTATATAAAATATATAAAAAAAATTACATATATACATGCATATTTGAAATCAA
CTACCTAGACATTCATGTGTTGCTCTAACATTTGCAATATTTCAAGTAATCAGGGATGTGATGCATCGATCTTACTCGATGGAGCCGATGGAGAGAAGTTTGCTTTACCAAACATCAATT
CGGCTCGGGGATTTGAGTTGGTGGATTCGATCAAAAGTGCTGTGGAAAGTTCATGCAGTGGAGTAGTTTCTTGTGCAGATATTCTGGCTGTAGCCGCTCGTTATTCAGTTGTCTTT
GTAA
GCATCATGAATATATACATGAAAATGAAAATTGTTGGTATCATCGTCATCGGAAACCCAGGACCATTCGGAACGGACGGTGTTGTGACCGCACACACAATCGTTTTCAAACAACCCACAA
TAATCACAATACTTCATCATGAACAATCTAACCGAATATATGCAGAATGATTATGAACTTACTGTGAATCGAACTGAACAAACTTGAACTTCAAACTAACCGCAAACTTTGAATAACAAT
AACTAATACGAACTAAACTTTATAAAACGAAATCTGATGTACATCAAATCTGGATTGTGCCGTGTATATATACGAGATGAAACGGTGTGTTCTTCAACCGTTGCGTCTCTTCACAAAGAG
ATATGTCGTTTGCATGATAACCGTACATACGGTTACTAATCATACTCGCATCGTTTCATCTTGTGCACAGCCCAAACCCAACTTGTTAAACCTAATGGACTTCTAGTGTTTGACCCATTA
CATAACATATGGCCTCCGGCCCAAATTCAAGACATAAACATAAAACACTTAAATTGTTCGACCCAATAAGAAAACTAAACAAATAATAATAGATACCGGCCCGTAACCGTTTCGGATGGA
CTTGATTATTGATCTTCATTCACCGCCCTAAGCAAGAACATCCGAGTCTCTAGCCGTGATCACTCCTTGCGATTGTTGGTGACCTCTATCTTGACCACCACTTCGTCGTCGCTTGATTCT
TCGAGCCAACCGCAGTTGTTACTTGAATTTCGAGCCATGACATCTTCCTTTTTTCCACGCTCCTTCTTCATGTAGTCGAAGTATCACTCGACTAGTTCCAAGTAATAGATGTAGGCGACT
TTCATCTCGTATGCATCATCCGGTTCATAACCGTACTTGGCCACGATTACATCCCACATATTCTTCTCCATCACTTCCTTAAACCCTCCGTTGTGCTTTACAATGCGATGTAACAATATG
AGACTAAGGTCTCGGCCATCAATCAACTCGGGTGGCATTGCTTTCTCACATACAATTCCAAGAAAATCCGAAATAAACCAAATCAAGACTTCTTTGAACGGTGCTTCGAAAAACCTTTGG
TGTTTCTTTATTTCCTCGTGCAACGTAATAAGATCTCCCGGTTCTACACAACTTTCCATAATCATGTTTCTTTCGATGACGTCTTCCTCGAGTTGTGAGAGAATTAACGCTCGTTCCCGA
AGCGTTTCTCTTGATTGACGCGGGTTATCTTTTTCGCCTTCAATGTAAATCAAAAGCGCCTTCTTTGCTTTCTTGGAATACACGACTTCCTTCTTTCTTGCCCTTGAATTTTCACCGTAC
ACCTTCTTCTTGTTTCTTTCTTTCTCGAATTCCTTTTCGTAGTATTCACCCAAACACTCTTGGAATTCTTTCTTTTCCTTCTTGTATCCGTTGTCAACGCCAAGATTATCATAGAAAGCG
TTGAGATAATCTTGTTCCAAGTCGACTTCCGACTTATCTTCATAAATGTCGAACCCTTTCGAGCGACATCCAGACATCTTCTTTAACACACACGTTTCCCCCGTTGTAACCGTTTCTATC
CCTTGAAACAAAAGTTGTTCTAGACTTAACACGTTCTTGTTTAGACTTGGAGCATAACTTACACACGGGATCGTCTTGTCTTTGCCGTCCACCGGCACTCTAACTTCTCCTATACCATGC
ACAAACGAAAAATCCTTCCTACTTTCGTTTGTCACAACCCCAAAGTGTCTATTGAAACACTTAAACATATTCCGGTTTCCTGTCATATGTGTTTTGAACGTAGGATCAACAACCCATATT
GAATCCCATTTGCCACCACAAGTGTCTTTAACCACATAATCACTTTCAATTGGTAACGGCGATAACTTGATATACTTAATTGGGCAAATCGAGGCGATGTGACCAAATTCCTTGCACTTG
AAGCAACGGATTCCCGGTTTCCTTGGCCTACCCACCGGTGCATTTGCTTTCTTACCGGACTTCTTCACGAATCCCTTTGGAACCATTTTCTTTGGAAACTTCTTCACCGGTGACTTCCCG
GTTCGCATGGTTGGCTTCCCCTGCGCGTACTCATCCTCTTCCGCCGCCCGGCCGCACTTTCCACTACGAACAATATCTTCAACGTAATCGGTTTCCACCGATTTTCCCTTGTCTCCACAA
ACCCGGTTCCCATCATGATCACAACTCCTTCCGCTTCCTGTTAAACCTTTGGCTCTGATACCAATGTTGGTATCATCGTCATCGGAAACCCAGGACCATTCGGAACGGACGGTGTTGTGA
CCGCACACACAATCGTTTTCAAACAACCCACAATAATCACAATACTTCATCATGAACAATCTAACCGAATATATGCAGAATGATTATGAACTTACTGTGAATCGAACTGAACAAACTTGA
ACTTCAAACTAACCGCAAACTTTGAATAACAATAACTAATACGAACTGAACTTTATAAAACGAAATCTGATGTACATCAAATCTGGATTGTGTCGTGTATATATACGAGATGAAACGGTG
TGTTCTTCAACCGTTGCGTCTCTTCACAAAGAGATATGTCGTTTGCATGATAACCGTACATACGGTTACTAATCATACTCGCACCGTTTCATCTTGTGCACAGCCCAAACCCAACTTGTT
AAACCTAATGGACTTCTAGTGTTTGACTCATTACATAACATATGGCCTCCGGCCCATATTCAAGACATAAACATAAAACACTTAAATTGTTCGACCCAATAAGAAAACTAAACAAATAAT
AATAGATACCGGCCCGTAACCGTTTCGGATGGACTTGATTATTGATCTTCAAAAACCGACCCAAAAACTAACTAGAAATGGTTTGCAGAGTGGAGGACGACGATATGACGTGCCACTAGG
AAGAAGAGATGGACTTGTGGCAAACCAAACGGGGGCTAACCTAATGTTACCTGCACCCTTTGAGACTCTGGGTAACATTACTCGCAAGTTTGAAGCTGTGGGCCTCAATATCACTGATGT
CGTCATACTTTCAG
GTTTGATAAAAAAAAAAATAGTTGGATCTGATACCAAATGGGCGTTGTTAAACATACACCACCCCTATCAGTCTACGCTAGCCCACATGTCACATCATATGGGCCA
CGTGACACGGTGAAAAAAGTTCGTACATGCCATATTGGTTTGCTAGTGGTCACATTAAGTCTTTGTTTGTCACATCAGTCAATTTTTTGTCGGTCTATATATCATATAGGTTGTATGATT
GGCCCTCGTACGATTAATATCGCCATTTTTTTCCATGTCATACCGCCATATGACCATTTTATCCATGCGATACAGGCTCGTATGACATGTGAGTGGTGTATGAATTGTTTTTTAGGTGTC
TAGAACAAAAGTGGTTAAATGATAAAAATATTTTTATATTTGAACCCTGTGTAGGTGCACATACATTTGGGAAAGCAAGTTGCGCAACATTTAGAAACAGATTATTCAACTTCTCTGGAA
CGAATGCACCTGATAGTACGTTACTTGACTCGAGTATGGTATCGGTTCTACAAAATCTATGTCCGGTGAATGGAGATGGTAGGCAAACGACAGCTCTTGACTGGAACTCGACTGAGAATT
TTGACAACCATTACTTTCGAAACTTGGTCAACGGGCGTGGACTTCTTGAATCTGATCAAGTGTTGTATTCGAGTGATGAGGCTATCTCAACTACACGAAGTCTTGTTGAGCTCTACAGCA
AAAACTGGCAGATTTTCTTGGATGATTTTAAGCATTCCATGGTGAAACTGGGGAATATTCAACCACTTACAGGATCTTCTGGGGAGATTAGGAAGAATTGCAGGGTTGTTAATTCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTTCAAACAACATTAATTTTGCATGGTTTATAACCATCTCAATGCTGTGTTTGCTTGCAACTTCTCAACTAACAACTGATTTCTACTCAAAGACATGTCCTAATCTTCGCACC
ATTGTACGTGACCAAATTACTAAGGTGATTAAAACTGAACCAAGAATGGCAGCTTCTTTGCTTCGGCTACACTTCCATGATTGTTTTGTAAAT
GGATGTGATGCATCGATCTTACTCGAT
GGAGCCGATGGAGAGAAGTTTGCTTTACCAAACATCAATTCGGCTCGGGGATTTGAGTTGGTGGATTCGATCAAAAGTGCTGTGGAAAGTTCATGCAGTGGAGTAGTTTCTTGTGCAGAT
ATTCTGGCTGTAGCCGCTCGTTATTCAGTTGTCTTT
AGTGGAGGACGACGATATGACGTGCCACTAGGAAGAAGAGATGGACTTGTGGCAAACCAAACGGGGGCTAACCTAATGTTACCT
GCACCCTTTGAGACTCTGGGTAACATTACTCGCAAGTTTGAAGCTGTGGGCCTCAATATCACTGATGTCGTCATACTTTCAG
GTGCACATACATTTGGGAAAGCAAGTTGCGCAACATTT
AGAAACAGATTATTCAACTTCTCTGGAACGAATGCACCTGATAGTACGTTACTTGACTCGAGTATGGTATCGGTTCTACAAAATCTATGTCCGGTGAATGGAGATGGTAGGCAAACGACA
GCTCTTGACTGGAACTCGACTGAGAATTTTGACAACCATTACTTTCGAAACTTGGTCAACGGGCGTGGACTTCTTGAATCTGATCAAGTGTTGTATTCGAGTGATGAGGCTATCTCAACT
ACACGAAGTCTTGTTGAGCTCTACAGCAAAAACTGGCAGATTTTCTTGGATGATTTTAAGCATTCCATGGTGAAACTGGGGAATATTCAACCACTTACAGGATCTTCTGGGGAGATTAGG
AAGAATTGCAGGGTTGTTAATTCATAG

Retrieve as FASTA