Entry information : HaPrx79 (HanXRQChr10g0309071)
Entry ID 13633
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx79 (HanXRQChr10g0309071)
Name (synonym) HaPrx79 (HanXRQChr10g0309071)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx79
start..stop
S start..stop
HaPrx95 593 0 1..319 15..334
HargPrx04 580 0 1..314 1..315
HaPrx78 550 0 1..319 1..318
LsPrx26 540 0 1..319 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 207672766..207672969 204 N° 2 207673124..207673315 192 N° 3 207673845..207674010 166 N° 4 207674815..207675212 398
join(207672766..207672969,207673124..207673315,207673845..207674010,207674815..2 07675212)


exon

Literature and cross-references HaPrx79 (HanXRQChr10g0309071)
DNA ref. HanXRQ genome:   HanXRQChr10 (207672766..207675212)
Protein sequence: HaPrx79 (HanXRQChr10g0309071)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (300)
PWM (Da):   %s   35182.56 (32955.5)  
PI (pH):   %s   8.98 (8.96) Peptide Signal:   %s   cut: 22 range:20-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKNQMLCLFFLSFYVTSSSYSQLTHNFYQHICPNVESIVRSAVTNKFNQTFATAPATLRLFFHDCFVRGCDASVLLSNAKAEKDHHDDLSLAGDGFDTVVKAKAAVDSNPSCRNKVSCADILALATRDVVALTGGPSYKVELGRRDGRISTRKGVQHKLPHADFNLDQLNTMFASHGLSQTDMIALSGAHTLGFSHCGQFSKRIHSKAGIDRTLNRQYALQLREMCPVNVDPRIAINMDPTTPQTFDNAYYKNLQQGKGLFTSDQVLFMDARSRPTVNLFASNNNAFNQAFVSAVTKLGRVGVLTGYQGEIRRDCCRVN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAACCAAATGCTATGTTTATTCTTCCTCTCTTTCTATGTTACTTCTTCATCTTACTCTCAACTCACACACAATTTCTACCAACACATTTGCCCAAACGTCGAATCAATAGTCCGA
TCAGCCGTCACCAACAAATTCAACCAAACTTTCGCCACCGCTCCAGCCACTCTTCGCCTCTTTTTTCACGACTGTTTTGTTCGG
GTATTCAAAGGAGGTTGCGGCGCAGCTTGTTGCCCG
TTTACCTGCCATCCTTCCTTATGTATTTTTTCTATCGTTTATTAACAAATTGCCATTTTAATATATAATATAATATAATATATCGTTTGTTTTGTGATATATATATATATATATATAGGG
ATGTGATGCTTCAGTGTTACTATCTAATGCAAAGGCTGAGAAGGACCATCATGATGACTTGTCGCTCGCCGGAGACGGGTTTGACACGGTGGTGAAAGCAAAGGCAGCCGTTGATAGCAA
CCCAAGTTGCCGGAATAAAGTGTCTTGTGCAGATATATTAGCTCTTGCCACTAGAGATGTTGTAGCTTTG
GTAAATATTATTATTATTATTTTCACATCACTTTTGCTTATTTTGCCACT
AGATGAGTGTATGGTAACACGCCAAAAAAGCTATCATTATTATTTCTTTTTGTAATGTAAAACTAGTGGGATACATTGCGCGATGGGCAGGAATTCGGTCCGTATCGGTTCAGTAAGTTC
GTTATGCGAGGAGGTTCCTTACGGTATTGGTAGGGTTCCGGCGCTTAGTACAACAACCGAAAAGAAACCCAAAAATAAAGTCGTGATATGCATAAAAGGATATCGACACGTGTTGTACAT
CGATCGAAAACCATAAAATACCAGGACCAGTTCTAATAATACCGATATTGATACCGATGTCGATATTGGATTAGTTCATCACGACATTAGTATGGTACCGCCACTTGCTATAACTTATCA
TACCTAAAAACACTATTTTTAATACAACTACATAAAAAAAATAGTATAAATTTGGGTTTTAGTTAAAAAGAAATAGAATCAATATTAAGTATTTGATTGATTTTATTATGGATACATAGA
CAGGTGGGCCATCATACAAGGTGGAATTAGGAAGGAGAGATGGTAGAATCTCTACAAGAAAAGGTGTTCAACACAAGCTTCCACATGCTGATTTTAACTTGGACCAACTAAACACCATGT
TCGCTTCTCATGGTCTATCTCAAACCGATATGATTGCACTTTCAG
GTAAATTGTTTCACACAAAAATTGTAGACATTACATATTTAAATACTCGTCGTTTTCGTTTAGAAAGTTATCGGT
TACAAGTTGTTTAATCGCCGATCTAACTTTTTGCAACTCTTCTTCATTCTCCCGTCAGTGCACTCTTCAAACCACGGGTTATTCGCTTCCACGTTGCTCACAATTTTTAAAAACAACCTT
TTTGACACACGAAACCTATGACGAAAAAAATCATCATTGTATTTCGGCTCTCCTCCACAATATAATCTGCCATAAGGGTTTCCTGGCCTTTTTCCTGATCACGACGGACATGTCTTTTTT
TACTAGATGTGCCCGTGTCTTCTAGTTCGGCTTGTTCGATGAGATATTTGAAAAAAATTAAACTACTATTGGTTGAGGAGAAATCATCGTCGGTAATGTCGGGTGGAATAAAAAAGGGTA
TTTCATCTCCCATTTTGAAAAATTGTGATATAAATGAGAAGAGAAATGGTTCGGTTTGTATTGTTTGGTTGAGAATAGTTTTGGTTTGTGTAAAATGGATTGTGAATGGTTTGGTTTAAA
TATAAATAAAATGTAATTTGAAAAAAAACTAACGGCATTATAGCCGACCATCCCCAACGTTTGAAAACAACCTTCAATCTATTCGGTGACTCCTCCCCACTCCCCTTTGTTTGCCGCACA
CTATGGGGATGGCGGCGGTGTTACCGCGCGGTAACAGGCTCACCGCAAGCCATCCCCGCACACGCCCCTTACACCCTTAATAGTTAAATGTTAATATTTTAATTTAATGTTTAAACTCTT
GTTTTAAAGGTGCACATACACTTGGATTCTCTCATTGTGGTCAATTCTCAAAACGTATTCATTCCAAGGCTGGAATAGACCGGACCCTAAATCGCCAATATGCTCTTCAGCTAAGAGAAA
TGTGTCCGGTTAATGTAGACCCAAGGATCGCGATTAACATGGACCCCACCACCCCGCAAACTTTCGACAATGCATATTATAAAAACCTCCAACAAGGGAAGGGCTTGTTTACCTCTGACC
AAGTCTTGTTCATGGACGCTCGGTCAAGGCCTACGGTTAACCTGTTTGCTTCTAACAACAATGCATTCAATCAGGCATTTGTGAGCGCCGTCACCAAACTTGGCCGTGTTGGGGTTTTGA
CCGGTTACCAGGGTGAAATTAGACGCGATTGTTGTAGGGTTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAACCAAATGCTATGTTTATTCTTCCTCTCTTTCTATGTTACTTCTTCATCTTACTCTCAACTCACACACAATTTCTACCAACACATTTGCCCAAACGTCGAATCAATAGTCCGA
TCAGCCGTCACCAACAAATTCAACCAAACTTTCGCCACCGCTCCAGCCACTCTTCGCCTCTTTTTTCACGACTGTTTTGTTCGG
GGATGTGATGCTTCAGTGTTACTATCTAATGCAAAG
GCTGAGAAGGACCATCATGATGACTTGTCGCTCGCCGGAGACGGGTTTGACACGGTGGTGAAAGCAAAGGCAGCCGTTGATAGCAACCCAAGTTGCCGGAATAAAGTGTCTTGTGCAGAT
ATATTAGCTCTTGCCACTAGAGATGTTGTAGCTTTG
ACAGGTGGGCCATCATACAAGGTGGAATTAGGAAGGAGAGATGGTAGAATCTCTACAAGAAAAGGTGTTCAACACAAGCTTCCA
CATGCTGATTTTAACTTGGACCAACTAAACACCATGTTCGCTTCTCATGGTCTATCTCAAACCGATATGATTGCACTTTCAG
GTGCACATACACTTGGATTCTCTCATTGTGGTCAATTC
TCAAAACGTATTCATTCCAAGGCTGGAATAGACCGGACCCTAAATCGCCAATATGCTCTTCAGCTAAGAGAAATGTGTCCGGTTAATGTAGACCCAAGGATCGCGATTAACATGGACCCC
ACCACCCCGCAAACTTTCGACAATGCATATTATAAAAACCTCCAACAAGGGAAGGGCTTGTTTACCTCTGACCAAGTCTTGTTCATGGACGCTCGGTCAAGGCCTACGGTTAACCTGTTT
GCTTCTAACAACAATGCATTCAATCAGGCATTTGTGAGCGCCGTCACCAAACTTGGCCGTGTTGGGGTTTTGACCGGTTACCAGGGTGAAATTAGACGCGATTGTTGTAGGGTTAACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTTCTGATA TAAACCATAC ACCACCACAA CACAATCTTA ATTATAACAA ACAAAACAAA ACACGAAAGC AAAAATGAAG AACCAAATGC TATGTTTATT CTTCCTCTCT TTCTATGTTA  CTTCTTCATC TTACTCTCAA CTCACACACA ATTTCTACCA ACACATTTGC CCAAACGTCG AATCAATAGT CCGATCAGCC GTCACCAACA AATTCAACCA AACTTTCGCC ACCGCTCCAG  CCACTCTTCG CCTCTTTTTT CACGACTGTT TTGTTCGGGG ATGTGATGCT TCAGTGTTAC TATCTAATGC AAAGGCTGAG AAGGACCATC ATGATGACTT GTCGCTCGCC GGAGACGGGT  TTGACACGGT GGTGAAAGCA AAGGCAGCCG TTGATAGCAA CCCAAGTTGC CGGAATAAAG TGTCTTGTGC AGATATATTA GCTCTTGCCA CTAGAGATGT TGTAGCTTTG ACAGGTGGGC  CATCATACAA GGTGGAATTA GGAAGGAGAG ATGGTAGAAT CTCTACAAGA AAAGGTGTTC AACACAAGCT TCCACATGCT GATTTTAACT TGGACCAACT AAACACCATG TTCGCTTCTC  ATGGTCTATC TCAAACCGAT ATGATTGCAC TTTCAGGTGC ACATACACTT GGATTCTCTC ATTGTGGTCA ATTCTCAAAA CGTATTCATT CCAAGGCTGG AATAGACCGG ACCCTAAATC  GCCAATATGC TCTTCAGCTA AGAGAAATGT GTCCGGTTAA TGTAGACCCA AGGATCGCGA TTAACATGGA CCCCACCACC CCGCAAACTT TCGACAATGC ATATTATAAA AACCTCCAAC  AAGGGAAGGG CTTGTTTACC TCTGACCAAG TCTTGTTCAT GGACGCTCGG TCAAGGCCTA CGGTTAACCT GTTTGCTTCT AACAACAATG CATTCAATCA GGCATTTGTG AGCGCCGTCA  CCAAACTTGG CCGTGTTGGG GTTTTGACCG GTTACCAGGG TGAAATTAGA CGCGATTGTT GTAGGGTTAA CTAGGAAAAT GATGACCGTA TTTTTTATTT ATCATAATAT CTATAATGTC  AATTTTGTTA TCGAATAAGT AGCTACAATG TTAAAATACA AGTAGCTTTT GAGGAACAAT CATGTTGATT ATGTTTGAAT AATGAATGCA CTTTATAGAT GAGAATATAA CATAAAAAAA  TTTGTATATC ACTCACCTTC TCTCCCTCGT TACATCAAAA AAATATTATT TACATATGTA TTTACAAATA TTATTTACAT ATGTATTTAA CATGCCCACT GAGGAAGCTT GAGATTTCCG  ACCGCAGGAT CGAAAACGTA TATACCAAAA AATTTCTATA AAACGAGGGG TCGAAAACAT ATATACCAAA AAATTACCCT CTTATACAAT TAGCAACACA CACCCCTTTA AAAAGTTTCC  CCCCAATAAC AATTAGCAAC ACACCCGTTC TAAAAGTTTC ACCGTTTCGT GTATTGAGGC ACACCCTTTC GGTTTCACCC TTTCATGTAT TTTATAACCT TTCATGTAAT AAAATAAGGC  ACATCTCGAA ACGTCATCCT ATACAACCGA CATTTAACAA AAACCGTCAC CGCCATATGG CGCACCCACC ACCAGCTCCC TCTCACCACC ACCATACGTT CCCGTAACAG TATCACTTCC  AACTATCGTT GATATAGCGC CAATTCCGGT ATCATCATAA TTCACGTAAT CTTCAACTTT ATGATCTATT GAATTGGAAG ACGGATATTG ACTCAATTGA AATCAGTTTA AGGGATGAAA  CTATTTTTTC AACACACCAC ATTTCAAATT CTGAATATTG AACAGAACGG ATCACCAACA AATATCAATT GATAATTGGA TGAGAGATTC AGGAATCAAG GACATCGGCA GATTCTAATA  CATATTACGA ACACACACAA TTGTGTGTCG ATCCAAATCG AAAACGGTGA ATGGATTTGG TTTTTTATTA CAAACAAATT GAAACCAGGA ACATCATCTT TGGTCCGCTT TGGTAATGTT  TGGATTCCTT TTATCATTTG ATATATTTGT TATAATTGTG CGCCATAATC AACAATTGCT TATTTTTTGT TTCGCTCGAT CTGGATGTTG AATTTTGCGA GTCGAATTTG CCCCGTGTGG  ATGTTGATCA TAAGGATGAA TACGGTAGCG AAAACGGTTC GCTTACTGAA TCGTGTGAGT TATGATCACA AGGCGAACGT GTTTCAATTA TGATCGTGAG TTTGAAGGAG AGGCGGGAAG  TTTCGGATTC TGCGGTTCTG TTGCCAGAAA AAGTTGAAGA GACAACGTTG TCTGATTGTA AGAGGGAGAA AACCGGGAAG AGGCAGCGAT AGTGATGGTG GAGAACAATG GTTATTTTGA  TGTCGGCGAG TGTGGTGATT GTGGCGGTGA GATATTTGAA AAGAAGCAAC ATGAAGGTTT TCTGATCCCT ACTTCGATTT CCAACAAATT TTCCCGCATC GAATTGGAAG AAACGGTTGC 
TGAGGAAGTT TTGGATGAAC CCGAACCTTT TAGCGAGCGA GGAGATGGAG GCCAA 

Retrieve as FASTA