Entry information : HaPrx82 (HanXRQChr11g0322111)
Entry ID 13636
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx82 (HanXRQChr11g0322111)
Name (synonym) HaPrx82 (HanXRQChr11g0322111)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx82
start..stop
S start..stop
HaPrx83 643 0 39..360 1..322
HaPrx87 642 0 39..360 1..322
HaPrx86 640 0 39..360 1..322
HaPrx85 636 0 39..360 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7382129..7382464 336 N° 2 7382553..7382741 189 N° 3 7382836..7382998 163 N° 4 7383318..7383712 395
join(7382129..7382464,7382553..7382741,7382836..7382998,7383318..7383712)


exon

Literature and cross-references HaPrx82 (HanXRQChr11g0322111)
DNA ref. HanXRQ genome:   HanXRQChr11 (7382129..7383712)
Protein sequence: HaPrx82 (HanXRQChr11g0322111)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360
PWM (Da):   %s   38768.94 Transmb domain:   %s   o4-26i47-64o
PI (pH):   %s   9.61
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHQLFSSASILSLHIPANAILSILFINIQTSPLLQLLTMAAKNTNMFPLIFSFIILGLAHHNLVNALSPNYYDQTCPNAESTITSVVKKAMLNDPTVPAALLRMHFHDCFIRGCDGSVLLNSTGKNKAEKDGPPNISLHAFYVIDHAKKAVEALCPKTVSCADILALAARDAVTLSGGPTWDVPKGRKDGRVSKATETRQLPAPTFNISQLQQSFAQRGLSMDDLVALSGGHTLGFAHCSSFQNRIHNFSSKQSVDPTLESSFAASLKSVCPAKNTAKNAGANLDSSPTTFDNRYYKLLLQGKSIFSSDQSLVTSAKTKALVSKFASSQQEFQKAFVKSMIKMSSISGGQEVRLDCRVVN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCAACTTTTTAGCAGTGCCTCCATCTTATCCCTACATATACCTGCCAATGCCATCCTCTCAATCTTATTCATCAACATTCAAACATCACCATTGTTGCAGCTTCTAACAATGGCA
GCCAAGAACACCAACATGTTTCCCCTTATTTTCAGTTTCATTATCTTAGGATTAGCCCATCATAACTTGGTGAATGCACTAAGTCCTAACTACTATGATCAAACATGCCCCAATGCTGAG
TCAACCATTACAAGTGTTGTCAAGAAAGCTATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATTAGG
GTGACTATTCTTATATTTCATTCA
TATGCATTTCAATGATTGTTTCGTCCTTTTGTTTGTTTATTGACGACTACATCGAATTTTGTAGGGATGCGATGGTTCGGTGTTGTTGAATTCAACTGGGAAAAACAAAGCTGAGAAAGA
TGGACCTCCAAACATATCTTTGCATGCATTTTATGTTATTGATCATGCCAAGAAAGCAGTAGAGGCTTTATGTCCAAAAACTGTCTCTTGTGCAGATATCTTGGCATTAGCAGCAAGGGA
TGCAGTCACTTTG
GTTAGTAAAGCATCTTTTTTTAATACCTAAAAGTTTACAGTTTATACATTTTGATTTTACGTTCGATTTGAGTTTTAACTTGAGTTGAATATAGTCTGGAGGGCCAA
CATGGGACGTGCCGAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCAACCGAAACACGACAATTACCAGCTCCAACATTCAATATTTCCCAACTGCAACAAAGTTTTGCTCAAAGAGGTC
TTTCCATGGATGATTTAGTTGCACTATCAG
GTAATTGACCAAATACTGGATCTTAAAGATTTCCAAAATCCAATGTCCAGATATCCGGGTTCTTAGCGACTCCATTTTAAACAAAGTAAC
AACTTTTTTTTACTCTTTAGTCATAATTTTTATCTTAAAAATCAAAATTATATAGCTAAAGATATAGTTTTAAATTTTACACTCATCCTTCTAGAATATATTTTACAAACATATAGTGAC
TGGTTTGTTACACGTTTTATAACTGTGTCACCCAAAATGATATTTTTATTGTAGTAACTGTTTTTGAGGCAAACGAAATAAAGATTATTATTTTCTGACCAATGTGTAGGAGGGCATACA
CTTGGGTTCGCGCATTGCTCATCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCGACACTGGAATCATCATTTGCAGCTAGTTTAAAGAGTGTATGCCCTGCA
AAAAACACAGCGAAAAATGCGGGTGCAAATCTTGATTCGAGTCCCACAACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAGAGTATATTCTCTTCTGATCAGTCGTTGGTC
ACATCGGCAAAGACCAAAGCACTGGTCTCAAAGTTTGCTAGTTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCTATGATTAAGATGAGTAGCATCAGTGGTGGGCAAGAGGTAAGG
CTCGACTGTAGAGTTGTAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCAACTTTTTAGCAGTGCCTCCATCTTATCCCTACATATACCTGCCAATGCCATCCTCTCAATCTTATTCATCAACATTCAAACATCACCATTGTTGCAGCTTCTAACAATGGCA
GCCAAGAACACCAACATGTTTCCCCTTATTTTCAGTTTCATTATCTTAGGATTAGCCCATCATAACTTGGTGAATGCACTAAGTCCTAACTACTATGATCAAACATGCCCCAATGCTGAG
TCAACCATTACAAGTGTTGTCAAGAAAGCTATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATTAGG
GGATGCGATGGTTCGGTGTTGTTG
AATTCAACTGGGAAAAACAAAGCTGAGAAAGATGGACCTCCAAACATATCTTTGCATGCATTTTATGTTATTGATCATGCCAAGAAAGCAGTAGAGGCTTTATGTCCAAAAACTGTCTCT
TGTGCAGATATCTTGGCATTAGCAGCAAGGGATGCAGTCACTTTG
TCTGGAGGGCCAACATGGGACGTGCCGAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCAACCGAAACACGACAA
TTACCAGCTCCAACATTCAATATTTCCCAACTGCAACAAAGTTTTGCTCAAAGAGGTCTTTCCATGGATGATTTAGTTGCACTATCAG
GAGGGCATACACTTGGGTTCGCGCATTGCTCA
TCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCGACACTGGAATCATCATTTGCAGCTAGTTTAAAGAGTGTATGCCCTGCAAAAAACACAGCGAAAAATGCG
GGTGCAAATCTTGATTCGAGTCCCACAACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAGAGTATATTCTCTTCTGATCAGTCGTTGGTCACATCGGCAAAGACCAAAGCA
CTGGTCTCAAAGTTTGCTAGTTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCTATGATTAAGATGAGTAGCATCAGTGGTGGGCAAGAGGTAAGGCTCGACTGTAGAGTTGTAAAC
TAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCAAC TTTTTAGCAG TGCCTCCATC TTATCCCTAC ATATACCTGC CAATGCCATC CTCTCAATCT TATTCATCAA CATTCAAACA TCACCATTGT TGCAGCTTCT AACAATGGCA  GCCAAGAACA CCAACATGTT TCCCCTTATT TTCAGTTTCA TTATCTTAGG ATTAGCCCAT CATAACTTGG TGAATGCACT AAGTCCTAAC TACTATGATC AAACATGCCC CAATGCTGAG  TCAACCATTA CAAGTGTTGT CAAGAAAGCT ATGTTGAATG ATCCAACAGT TCCTGCTGCA CTTCTAAGAA TGCATTTCCA TGATTGCTTC ATTAGGGGAT GCGATGGTTC GGTGTTGTTG  AATTCAACTG GGAAAAACAA AGCTGAGAAA GATGGACCTC CAAACATATC TTTGCATGCA TTTTATGTTA TTGATCATGC CAAGAAAGCA GTAGAGGCTT TATGTCCAAA AACTGTCTCT  TGTGCAGATA TCTTGGCATT AGCAGCAAGG GATGCAGTCA CTTTGTCTGG AGGGCCAACA TGGGACGTGC CGAAAGGAAG AAAGGATGGA AGAGTTTCGA AAGCAACCGA AACACGACAA  TTACCAGCTC CAACATTCAA TATTTCCCAA CTGCAACAAA GTTTTGCTCA AAGAGGTCTT TCCATGGATG ATTTAGTTGC ACTATCAGGA GGGCATACAC TTGGGTTCGC GCATTGCTCA  TCCTTTCAGA ACAGGATACA CAACTTTAGT TCAAAGCAAA GTGTCGACCC GACACTGGAA TCATCATTTG CAGCTAGTTT AAAGAGTGTA TGCCCTGCAA AAAACACAGC GAAAAATGCG  GGTGCAAATC TTGATTCGAG TCCCACAACT TTTGACAATA GATATTATAA GTTACTTCTC CAAGGCAAGA GTATATTCTC TTCTGATCAG TCGTTGGTCA CATCGGCAAA GACCAAAGCA  CTGGTCTCAA AGTTTGCTAG TTCACAACAA GAGTTCCAGA AAGCATTTGT GAAATCTATG ATTAAGATGA GTAGCATCAG TGGTGGGCAA GAGGTAAGGC TCGACTGTAG AGTTGTAAAC  TAAACCAAAC TGGTGGAAAA AGAACTAATT AAATGTTCTC AGGTGAAATA TGTTTATCTT TTTCTGTTGA TTTCATTGGT GTTTGAAGGA TTATTGATCC AAAAGTTTAG TCATGTGTTG 
TATTTGTAAT GGGTACTAAT AATATTTATT TTTTAGTGAA AATGTTCCA 

Retrieve as FASTA