Entry information : HaPrx83 (HanXRQChr11g0322121)
Entry ID 13637
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx83 (HanXRQChr11g0322121)
Name (synonym) HaPrx83 (HanXRQChr11g0322121)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx83
start..stop
S start..stop
HaPrx87 656 0 1..322 1..322
HaPrx84 642 0 1..322 1..322
HaPrx82 643 0 1..322 39..360
HaPrx86 636 0 1..322 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7390857..7391078 222 N° 2 7391176..7391364 189 N° 3 7391458..7391620 163 N° 4 7391956..7392350 395
join(7390857..7391078,7391176..7391364,7391458..7391620,7391956..7392350)


exon

Literature and cross-references HaPrx83 (HanXRQChr11g0322121)
DNA ref. HanXRQ genome:   HanXRQChr11 (7390857..7392350)
Protein sequence: HaPrx83 (HanXRQChr11g0322121)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (301)
PWM (Da):   %s   34591.62 (32342.4) Transmb domain:   %s   i7-26o
PI (pH):   %s   9.61 (9.46) Peptide Signal:   %s   cut: 22 range:22-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKNTNMLSLIFSFIILGLAHLNLVNTLSANYYDQTCPNAESTITSVVKKAMLNDPTVPAALLRMHFHDCFIRGCDGSVLLNSTGKNKAEKDGPPNISLHAFYVIDNAKKAVEALCPKTVSCADILALAARDAVTLSGGPTWDVPKGRKDGRVSKATETRQLPAPTFNLSQLQQSFAQRGLSMDDLVALSGGHTLGFAHCSSFQNRIHNFSSKQSVDPTLESSFAASLKSVCPAKNTAKNAGANLDATPTTFDNRYYKLLLQGKSIFSSDQSLINSAKTKALVSKFASSQQEFQKAFVKSMIKMSSISGGQEVRHDCRVVN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCAAGAACACCAACATGCTTTCCCTTATTTTCAGTTTCATTATCTTAGGATTAGCCCATCTTAACTTGGTTAATACACTAAGTGCTAATTACTATGATCAAACATGCCCCAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCTATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATCAGG
GTGATTCTTCTTCTTCTT
CTTCTTCCACTTACAAGTCATATGCAAAACAATAAATCATTTTGATTAATTGTTGATTACTAAACTTAAAACTTTGTAGGGGTGTGATGGTTCGGTGTTGTTGAACTCAACTGGGAAGAA
CAAAGCTGAGAAAGATGGACCTCCAAACATATCATTGCACGCATTCTATGTTATTGATAATGCCAAGAAAGCGGTAGAGGCTTTATGTCCTAAAACTGTATCTTGTGCAGATATCTTGGC
ATTAGCAGCAAGGGATGCAGTCACTTTG
GTTAGTAAAGCATCTTTTTTAATACCTAAAAGTTTACAAATTTTACAGTTTGATTTTAATTTTGTTTCGAGTTTAAACTTGATTTGAATATA
GTCTGGAGGGCCAACATGGGATGTGCCAAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCTACCGAAACACGACAATTACCTGCTCCAACATTCAATCTTTCCCAATTGCAACAAAGTTT
TGCACAAAGAGGTCTTTCCATGGATGATTTAGTTGCACTATCAG
GTAATTAATTGACCAAATATTACCTAAAATTTCCAGATAACCGGAACTGTTTATTTTAACGAGTTGATTTACCTAG
AATGTCCAGATATCCGGGTTCTTAGTGACTCCATTTTAAACAAGACAAAACTTTTTGCTCTTTATAATATTTATCTTAACTATAGCTAAAAGATATAGTTTTAAAGATTACTCTTATCCT
TCAAGAATATATTTTACAAACATATAGTAACTGATTTGTTACACGTTTTATAAATGTGTCACCCAAAATGTTATTTTTCTTGTAGTAATTTTTTTGAAGCAAACGAAATAAAGATTATTA
TTTGCTGACCAATGTGTAGGAGGACATACACTTGGGTTCGCTCATTGCTCATCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCAACTCTGGAATCATCATTT
GCAGCCAGTTTAAAGAGTGTATGCCCTGCAAAAAACACAGCGAAAAATGCGGGTGCAAATCTTGATGCGACTCCAACAACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAG
AGTATATTCTCTTCTGATCAGTCGTTGATCAATTCGGCAAAGACGAAAGCATTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCCATGATTAAGATG
AGCAGCATCAGTGGTGGGCAAGAGGTAAGGCACGACTGTAGAGTGGTAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCAAGAACACCAACATGCTTTCCCTTATTTTCAGTTTCATTATCTTAGGATTAGCCCATCTTAACTTGGTTAATACACTAAGTGCTAATTACTATGATCAAACATGCCCCAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCTATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATCAGG
GGGTGTGATGGTTCGGTG
TTGTTGAACTCAACTGGGAAGAACAAAGCTGAGAAAGATGGACCTCCAAACATATCATTGCACGCATTCTATGTTATTGATAATGCCAAGAAAGCGGTAGAGGCTTTATGTCCTAAAACT
GTATCTTGTGCAGATATCTTGGCATTAGCAGCAAGGGATGCAGTCACTTTG
TCTGGAGGGCCAACATGGGATGTGCCAAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCTACCGAAACA
CGACAATTACCTGCTCCAACATTCAATCTTTCCCAATTGCAACAAAGTTTTGCACAAAGAGGTCTTTCCATGGATGATTTAGTTGCACTATCAG
GAGGACATACACTTGGGTTCGCTCAT
TGCTCATCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCAACTCTGGAATCATCATTTGCAGCCAGTTTAAAGAGTGTATGCCCTGCAAAAAACACAGCGAAA
AATGCGGGTGCAAATCTTGATGCGACTCCAACAACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAGAGTATATTCTCTTCTGATCAGTCGTTGATCAATTCGGCAAAGACG
AAAGCATTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCCATGATTAAGATGAGCAGCATCAGTGGTGGGCAAGAGGTAAGGCACGACTGTAGAGTG
GTAAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCA AGAACACCAA CATGCTTTCC CTTATTTTCA GTTTCATTAT CTTAGGATTA GCCCATCTTA ACTTGGTTAA TACACTAAGT GCTAATTACT ATGATCAAAC ATGCCCCAAT  GCTGAATCAA CCATTACAAG TGTTGTCAAG AAAGCTATGT TGAATGATCC AACAGTTCCT GCTGCACTTC TAAGAATGCA TTTCCATGAT TGCTTCATCA GGGGGTGTGA TGGTTCGGTG  TTGTTGAACT CAACTGGGAA GAACAAAGCT GAGAAAGATG GACCTCCAAA CATATCATTG CACGCATTCT ATGTTATTGA TAATGCCAAG AAAGCGGTAG AGGCTTTATG TCCTAAAACT  GTATCTTGTG CAGATATCTT GGCATTAGCA GCAAGGGATG CAGTCACTTT GTCTGGAGGG CCAACATGGG ATGTGCCAAA AGGAAGAAAG GATGGAAGAG TTTCGAAAGC TACCGAAACA  CGACAATTAC CTGCTCCAAC ATTCAATCTT TCCCAATTGC AACAAAGTTT TGCACAAAGA GGTCTTTCCA TGGATGATTT AGTTGCACTA TCAGGAGGAC ATACACTTGG GTTCGCTCAT  TGCTCATCCT TTCAGAACAG GATACACAAC TTTAGTTCAA AGCAAAGTGT CGACCCAACT CTGGAATCAT CATTTGCAGC CAGTTTAAAG AGTGTATGCC CTGCAAAAAA CACAGCGAAA  AATGCGGGTG CAAATCTTGA TGCGACTCCA ACAACTTTTG ACAATAGATA TTATAAGTTA CTTCTCCAAG GCAAGAGTAT ATTCTCTTCT GATCAGTCGT TGATCAATTC GGCAAAGACG  AAAGCATTGG TCTCAAAGTT TGCTAGCTCA CAACAAGAGT TCCAGAAAGC ATTTGTGAAA TCCATGATTA AGATGAGCAG CATCAGTGGT GGGCAAGAGG TAAGGCACGA CTGTAGAGTG 
GTAAACTAA 

Retrieve as FASTA