Entry information : HaPrx84 (HanXRQChr11g0322131)
Entry ID 13638
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2017-11-23 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx84 (HanXRQChr11g0322131)
Name (synonym) HaPrx84 (HanXRQChr11g0322131)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx84
start..stop
S start..stop
HaPrx86 662 0 1..322 1..322
HaPrx83 642 0 1..322 1..322
HaPrx87 640 0 1..322 1..322
HaPrx[P]129 638 0 1..322 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7414238..7414459 222 N° 2 7414554..7414742 189 N° 3 7414837..7414999 163 N° 4 7415292..7415686 395
join(7414238..7414459,7414554..7414742,7414837..7414999,7415292..7415686)


exon

Literature and cross-references HaPrx84 (HanXRQChr11g0322131)
DNA ref. HanXRQ genome:   HanXRQChr11 (7414238..7415686)
Protein sequence: HaPrx84 (HanXRQChr11g0322131)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322
PWM (Da):   %s   34817.59 Transmb domain:   %s   i7-26o
PI (pH):   %s   9.42
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MADKNTNMFYLIFSFTIFGLAHFNLVNTLSANYYDQTCHNAESTITSVVKKAMLNDPTVPAALLRMHFHDCFIRGCDGSVLLNSTGKNKAEKDGPPNISLHAFYVIDNAKKAVEALCPKTVSCADILALAARDAVTLSGGPTWGVPKGRKDGRVSKATETRQLPAPTFNISQLQQSFAQRGLSMDDLVALSGGHTLGFAHCSSFQNRIHNFSSKQSVDPTLESSFAASLKSVCPAKNTAKNAGANLDATPTTFDNRYYKLLLQGKSIFSSDQSLINSAKTKALVSKFASSQQEFQKAFVKSMIKMSSISGGQEVRLDCRVVN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGACAAGAACACCAATATGTTTTACCTTATTTTCAGTTTCACTATCTTTGGATTAGCCCATTTTAACTTGGTTAATACCCTAAGTGCTAATTACTATGATCAAACATGCCACAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCAATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATTAGG
GTGATTATTCTTCTACTT
CTTCCACTTACATGTCATATGCAAAACAGTAAATCATTTTGATTAATTGTTGATTACTAAACTTAAAACTTTGTAGGGGTGTGACGGTTCGGTGTTGCTGAACTCAACCGGGAAGAACAA
AGCTGAGAAAGATGGACCTCCAAACATATCTTTGCATGCATTTTATGTTATTGATAATGCCAAGAAAGCAGTAGAGGCTTTATGTCCTAAAACTGTCTCTTGTGCAGATATCTTGGCATT
AGCAGCAAGGGATGCAGTCACTTTG
GTTAGTAAAGCATCTTTTTTTAGTAACTAAAAGTTTACAAATTTTACAATTTGATTTTAATTTCGTTTCGAGTTTAAACTTGATTTAAATATAGT
CCGGAGGGCCAACATGGGGTGTGCCAAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCTACCGAAACACGACAATTACCAGCTCCAACATTCAATATTTCCCAATTGCAACAAAGTTTTG
CACAAAGAGGTCTTTCCATGGATGATTTAGTTGCGTTATCAG
GTAATTGACCAAATATTACCTAAAATTTCCAGATATCCGGGTTCTTAGTGACTCCATTTTAAACAAAGTAACAAAACT
TTTTGCTCTTTAGTCATAATATTTATCTTATAATTATAGCTAAAAGATATAGTTTTAAAGATTACTCTTATCCTTCAAGAATATATTTTACAAACATATAGTAACCGATTTGTTACACGT
TTTATAAATGTGTCACCCAAAATGTTATTTTTCTTATATTAATTTTTTTTGAAGCAAACGAAATAAAGATTATTATTTGCTGATCAATGTGTAGGAGGACATACACTTGGGTTCGCTCAT
TGCTCATCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCAACTCTGGAATCATCATTTGCAGCCAGTTTAAAGAGTGTATGCCCTGCAAAAAACACAGCGAAA
AATGCCGGTGCAAATCTTGATGCGACTCCCACAACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAGAGTATATTCTCTTCTGATCAGTCGTTGATCAATTCGGCTAAGACG
AAAGCATTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCCATGATTAAGATGAGTAGCATCAGTGGTGGGCAAGAGGTAAGGCTCGACTGTAGAGTT
GTAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGACAAGAACACCAATATGTTTTACCTTATTTTCAGTTTCACTATCTTTGGATTAGCCCATTTTAACTTGGTTAATACCCTAAGTGCTAATTACTATGATCAAACATGCCACAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCAATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATTAGG
GGGTGTGACGGTTCGGTG
TTGCTGAACTCAACCGGGAAGAACAAAGCTGAGAAAGATGGACCTCCAAACATATCTTTGCATGCATTTTATGTTATTGATAATGCCAAGAAAGCAGTAGAGGCTTTATGTCCTAAAACT
GTCTCTTGTGCAGATATCTTGGCATTAGCAGCAAGGGATGCAGTCACTTTG
TCCGGAGGGCCAACATGGGGTGTGCCAAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCTACCGAAACA
CGACAATTACCAGCTCCAACATTCAATATTTCCCAATTGCAACAAAGTTTTGCACAAAGAGGTCTTTCCATGGATGATTTAGTTGCGTTATCAG
GAGGACATACACTTGGGTTCGCTCAT
TGCTCATCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCAACTCTGGAATCATCATTTGCAGCCAGTTTAAAGAGTGTATGCCCTGCAAAAAACACAGCGAAA
AATGCCGGTGCAAATCTTGATGCGACTCCCACAACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAGAGTATATTCTCTTCTGATCAGTCGTTGATCAATTCGGCTAAGACG
AAAGCATTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCCATGATTAAGATGAGTAGCATCAGTGGTGGGCAAGAGGTAAGGCTCGACTGTAGAGTT
GTAAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGACA AGAACACCAA TATGTTTTAC CTTATTTTCA GTTTCACTAT CTTTGGATTA GCCCATTTTA ACTTGGTTAA TACCCTAAGT GCTAATTACT ATGATCAAAC ATGCCACAAT  GCTGAATCAA CCATTACAAG TGTTGTCAAG AAAGCAATGT TGAATGATCC AACAGTTCCT GCTGCACTTC TAAGAATGCA TTTCCATGAT TGCTTCATTA GGGGGTGTGA CGGTTCGGTG  TTGCTGAACT CAACCGGGAA GAACAAAGCT GAGAAAGATG GACCTCCAAA CATATCTTTG CATGCATTTT ATGTTATTGA TAATGCCAAG AAAGCAGTAG AGGCTTTATG TCCTAAAACT  GTCTCTTGTG CAGATATCTT GGCATTAGCA GCAAGGGATG CAGTCACTTT GTCTGGAGGG CCAACATGGG ATGTGCCAAA AGGAAGAAAG GATGGAAGAG TTTCGAAAGC TACCGAAACA  CGACAATTAC CTGCTCCAAC ATTCAATATT TCCCAATTGC AACAAAGTTT TGCACAAAGA GGTCTTTCCA TGGATGATTT AGTTGCACTA TCAGGAGGAC ATACACTTGG GTTCGCTCAT  TGCTCATCCT TTCAGAACAG GATACACAAC TTTAGTTCAA AGCAAAGTGT CGACCCGACT CTGGAATCGT CATTTGCAGC CAGTTTAAAG AGTGTATGCC CTGCAAAAAA CACAGCGAAA  AATGCGGGTG CAAATCTTGA TGCGACTCCC ACAACTTTTG ACAATAGATA TTATAAGTTA CTTCTCCAAG GCAAGAGTAT ATTCTCTTCT GATCAGTCGT TGATCAATTC GGCAAAGACG  AAAGCATTGG TCTCAAAGTT TGCTAGCTCA CAACAAGAGT TCCAGAAAGC ATTTGTGAAA TCCATGATTA AGATGAGTAG CATCAGTGGT GGGCAAGAGG TAAGGCTCGA CTGTAGAGTT 
GTAAACTAAG CCAAACTGGT GGAAAAAGA 

Retrieve as FASTA