Entry information : HaPrx85 (HanXRQChr11g0322141)
Entry ID 13639
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx85 (HanXRQChr11g0322141)
Name (synonym) HaPrx85 (HanXRQChr11g0322141)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx85
start..stop
S start..stop
HaPrx87 637 0 1..320 1..322
HaPrx83 635 0 1..320 1..322
HaPrx82 636 0 1..320 39..360
HaPrx84 625 0 1..320 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7455509..7455730 222 N° 2 7455819..7456001 183 N° 3 7459504..7459666 163 N° 4 7459958..7460352 395
join(7455509..7455730,7455819..7456001,7459504..7459666,7459958..7460352)


exon

Literature and cross-references HaPrx85 (HanXRQChr11g0322141)
DNA ref. HanXRQ genome:   HanXRQChr11 (7455509..7460352)
Protein sequence: HaPrx85 (HanXRQChr11g0322141)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (292)
PWM (Da):   %s   34374.51 (31299.9) Transmb domain:   %s   i7-26o
PI (pH):   %s   9.46 (9.28) Peptide Signal:   %s   cut: 29 range:29-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKNTNMFSLIFSFIILGLAHLNLVNTLSPSYYDQTCPNAESTITSVVKKAMLNDPTVPAALLRMHFHDCFIRGCDGSVLLNSTGKNKAEKDGPPNISLHTFYVIDNAKKAVEALCPKTVSCTDILALAARDAVSGGPTWDVPKGRKDGRVSKATETRQLPAPTFNISQLQQSFAQRGLSIDDLVALSGGHTLGFAHCSSFQNRIHNFSSKQSVDPTLESSFAASLKSVCPATNTAKNAGANLDATPTTFDNRYYKLLLQGKSIFSSDQSLVTSAKTKALVSKFASSQQEFQKAFVKSMIKMSSISGGQEVRLDCRVVN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCAAGAACACCAACATGTTTTCCCTTATTTTCAGTTTCATTATATTAGGATTAGCCCATCTTAACTTGGTTAATACACTAAGTCCTAGTTACTATGATCAAACATGCCCCAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCTATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATCAGG
GTGATTCTTCTTCTTCCA
CTTACATGTCATATGCAAAACAGTAAATCATTTTGATTAATTGTTGATTACTAAACTTAAAACTTTGTAGGGGTGCGATGGTTCGGTGTTGTTGAACTCAACTGGGAAGAACAAAGCTGA
GAAAGATGGACCTCCTAACATATCATTGCACACATTCTATGTTATTGATAATGCCAAGAAAGCAGTAGAGGCTTTATGTCCTAAAACTGTATCTTGTACAGATATCTTAGCATTAGCAGC
AAGGGATGCAGTT
GTAAGATTAAATATATTTATTTTATATTTAATCTAGTAGCCATTATAATCATTTACATTATACGGATCAAAATATATAACAATCCTATTAAATAATTAGTTGGTAAT
TGTTGATGGGCCTAATTACCCTTATTAATTAATTAGGGTTTCCTCCTGGGTGCATATATAAGGAGAATAATGTGGAGGTTAAAGGGTTAGATATTTTCACAAACCCTAATAGCACATAAC
ATCAATCTCGCCTCCCTCTCCACAACCGATTCCCTTGTCGGTTTCTTATCATCACCATCATTAGATTGCACCCTAAGGAGGAACCAGACCAAGATGACAATCATGTCAAAACTTATTGCT
GTGTCTCCATCTGGATTCTCTGTTGGCCTGTACTGCTGCAATCAGGTATGTTTTCATGTTTTCCTTTATGCCTAAAACAGAACTGGCCAACATGTGGTATCAGAGCATATGTTGATTAAT
CAGTTATGTTTTCGTATCCATTAATTCTGGGATTGAAATCTGGAAAGTGGAATTTTGAAAGCCTAATTAAATTCATAAGCCGGTTTCGAGTCACATAACCTGAGTCCTCTGTTTCGGGAA
AAAGAAAGGAAAAAGAATGTTTTTTAATGAGTCGGAATCATAATGGTAAATCTTAACTGTACCGAAATCTGTTTAAAGCCTTAAAATTCAGGTTTCGGGTTCCAGAATTATTATTTTATT
TATTAGGGTTCTTCATGTTCTTAGTGAAATTCGAATAAATTCCCTTATTTTGGAATGAATTAAGGATTAGAAGGTGTTTTTCCTGTATTTGATTAACTTTTATCTCTTAAGATTTCGAAA
AATCTGTTAATGTTATTAGATATAATTTTCAAAATTATTGGATAAATATAAAATATCTTTTAAAGCAGGAAATAAAATATACCAAATCCCTTAAAATTCGAATTTCAAACTTATCACACT
AACAGCTGTTAACGGGAGTTTCGAGATCATTTGTTTAACGACTCAAGACCATAAGGTCTCTACTCGAGACCATAAGGTCTCTACTCGAAATCATAAGTGTTCTCAAATGTTTACAACTCG
AGACAACGATTTTGACTCGAGATCATAAGGTCACGGACTCGAGACCACCGAGGTTTCGACTAAGGGCTTAAATCTGTACAACTCGAGACAAAGGTCTCGACTCGAGACCATAAAGGTCAC
AACTCGAGACCATGGTTGCGACTCGAGACCTCATAAGGAGTCGAGATCTCATAATTCACAGCAGTCGAGACCATGATTACGACTCGAGACACTGAGGTTGCGACTCAAGACCATTAATGA
GTCGAGACCTCATAATGTTATAAGCTGAGTCGAGACTTGACTCGAGACCTCATAACTGACTCGAGATCTCATAACTCAGTCGAGATCTCACTTGAAACCTCATTATTTTAGGCTGTTTAA
TGTGAACTAAGATTTAGCTCGGGGCTCTGCGCTAACAGGTGGTTTGCTATTAAATGATTGGTTTTTGTAATTACTTAGTTAATTAATGAGGATCAAATAATGTTTTACAAAACCAAAATG
GCTTAACTTGAATGAGCTTCTGATGTGTCACTTCTGGCCAAAGCTGATTTGATGCATCTACTTATCGTTCAAGTATTACGAAAGCTATGTTAAGTGTGCATCATAATCATGAATGTCTTA
ATATCTGGCCAAAGCTGATTTAATTCCTTCATAGATGGCATACTTAACAAGTGCATAACTAAAGTGATTGTCTCAATTTCTGGCCAAAGCTGATTTGTTACAACCACTTTGCACACATGC
TTAAATGATTACACTTCTAGCCAAAGCTGTTTTGTCTTCGTTTAAGTAGAACTTTAAGTAGTCTATTATTTTGATGTTAGTAATAGACATATCACAACCTCTTCACACAATGATCCTTAT
ATTAATGATCCTCAATTAATTTTTATGATCATTTGGTCTGCTTATTCTTAGTACCCATAATTTTACTCACTATAATTTTCTTCTATAAATCTATATCTCATCCACTCTAATTCCTAAATC
TCATATGTTTTGCTTAAAGTTTCTATAAAAATTAGCTCTTAAATTAAATCCTTGATTATCTCTTAAGACACGATGATCCTATTGCTCTCTTCTGATAAAGCACTACAGAAGAAAAGTAGA
GCATGATGAATAGGACAAATCAAACATGATGTCTCTTCTGATAATCAAGAACTCAGTAACATAAGTGCTGTCACTAAAAGGTTATTCCAGATTAGGTCTTTCCTAAGACTAATCTATAAT
TGTGGAATAATCACTAGAACTCCTAAGATGCATGCCTTCATTTAAAATTATAAATTATAAAGCTAAGTGGTATATGTGAATACATAACAATGTACAATACCATGACCCATAAAGTTAAGG
GCTTACACATGGAAATAAGTATATTTTTCCAGTACATTACATACTAAGATTTTCACTTGTACAATTTGATGCCTTATAAATCAACTATAACACTCAAAAATACCAAATTATAACGAGTGT
GTTGATAAGCAACATATCTACATAGAAATAAATGTTTGAAATTGGAAAATAAGATGTTATTCACCTTATATAAGTCTTATTAAGAGAGCTCATAGACGGGTATTAATTAATGGCCGTGCG
CAATTGCATATCGTACTATGAATGACTAAGTATTAGTTAATTTTCCTCATCAGTTTGATTTTGTATGTCTCTAAGAATATGTCAAGCCGGTATAATGGCATATAGACAAATAAAGTTACA
AATCAAACAAAGGGCTTATGCGTATTTTGATCATAACGATTAGGTTTTAAATTAAGGCTATAGTATGATTAATGGGGGTCCTGAGTCGCATAATGATTCAACGGCTGTATTTCTCTGCTA
TAATACTTGTTTAAGGCTAAAATGAGTGTTAACTCCTGATCAGGCTTATCTAACACTCATAGTAAATGATTACTCGGCTAAGTGGGAGAATGTAAGATTAAATATATTTATTTTATATTT
AATCTAGTAGCCATTATAATCATTTACATTATATGGATCAAAATATATAACAATCCTATTAAATAATTAGTTGGTAATTGTTGATGGGCCTAATTACCCTTATTAACTAATTAGGGTTTC
CTCCTGGGTGCATATATAAGGAGAATAATGTGGAGGTTAAAGGGTTAGATATTTTCACAAACCCTAATAGCACATAACATCAATCTCGCCTCCCTCTCCATAACCGATTCCCTTGTCGGT
TTCTTATCATCACCATCATTAGATTGCACCCTAAGGAGGAACCAGACCAAGATGACAATCATGTCAAAACTTATTGCTGTGTCTCCATCTGGATTCTCTGTTGGCCTGTACTGCTACAAT
CAGGTATGTTTTCATGTTTTCCTTTATGCCTAAAACAGAACTGACCAACAGCAGTCACTTTGGTTAGTAAAGCATCTTTTTTAAAAACTAAAAGTTTACAAATTTTACAATTTGATTTTA
ATTTCGTTTCGAGTTTAAACTTGATTTGAATATAGTCCGGAGGGCCAACATGGGATGTGCCAAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCTACCGAAACACGACAATTACCTGCTC
CAACATTCAATATTTCCCAATTGCAACAAAGTTTTGCACAAAGAGGTCTTTCCATAGATGATTTAGTTGCACTATCAG
GTAATTGACCAAATATCACCTAGAATGTCCAGATATCCGGGT
TCTTAGTGACTCCATTTTAAACAAAGTAACAAAACTTTTTGCTCTTTAGTAATAATATTTATCTTATAATTATAGCTAAAAGATATAGTTTTAAAGATTACTCTTATCCTTCAAGAATAT
ATTTTACAAACATATAGTAACTGATTTGTTACACGTTTTACAAATGTGTCACCCAAAATGTTATTTTTCTTGTAGTAATTTTTTTGAAGCAAATGAAATAAAGATTATCATTTGCTGACC
AATGTGTAGGAGGACATACACTTGGGTTCGCTCATTGCTCATCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCGACTCTGGAATCATCATTTGCAGCCAGTT
TAAAGAGTGTATGCCCTGCAACAAACACAGCGAAAAATGCGGGTGCAAATCTTGATGCGACTCCCACAACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAGAGTATATTCT
CTTCTGATCAGTCGTTGGTCACATCGGCAAAGACCAAAGCATTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCCATGATTAAGATGAGTAGCATCA
GTGGTGGGCAAGAGGTAAGGCTCGACTGTAGAGTGGTAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCAAGAACACCAACATGTTTTCCCTTATTTTCAGTTTCATTATATTAGGATTAGCCCATCTTAACTTGGTTAATACACTAAGTCCTAGTTACTATGATCAAACATGCCCCAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCTATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATCAGG
GGGTGCGATGGTTCGGTG
TTGTTGAACTCAACTGGGAAGAACAAAGCTGAGAAAGATGGACCTCCTAACATATCATTGCACACATTCTATGTTATTGATAATGCCAAGAAAGCAGTAGAGGCTTTATGTCCTAAAACT
GTATCTTGTACAGATATCTTAGCATTAGCAGCAAGGGATGCAGTT
TCCGGAGGGCCAACATGGGATGTGCCAAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCTACCGAAACACGACAA
TTACCTGCTCCAACATTCAATATTTCCCAATTGCAACAAAGTTTTGCACAAAGAGGTCTTTCCATAGATGATTTAGTTGCACTATCAG
GAGGACATACACTTGGGTTCGCTCATTGCTCA
TCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCGACTCTGGAATCATCATTTGCAGCCAGTTTAAAGAGTGTATGCCCTGCAACAAACACAGCGAAAAATGCG
GGTGCAAATCTTGATGCGACTCCCACAACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAGAGTATATTCTCTTCTGATCAGTCGTTGGTCACATCGGCAAAGACCAAAGCA
TTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCCATGATTAAGATGAGTAGCATCAGTGGTGGGCAAGAGGTAAGGCTCGACTGTAGAGTGGTAAAC
TAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCA AGAACACCAA CATGTTTTCC CTTATTTTCA GTTTCATTAT ATTAGGATTA GCCCATCTTA ACTTGGTTAA TACACTAAGT CCTAGTTACT ATGATCAAAC ATGCCCCAAT  GCTGAATCAA CCATTACAAG TGTTGTCAAG AAAGCTATGT TGAATGATCC AACAGTTCCT GCTGCACTTC TAAGAATGCA TTTCCATGAT TGCTTCATCA GGGGGTGCGA TGGTTCGGTG  TTGTTGAACT CAACTGGGAA GAACAAAGCT GAGAAAGATG GACCTCCTAA CATATCATTG CACACATTCT ATGTTATTGA TAATGCCAAG AAAGCAGTAG AGGCTTTATG TCCTAAAACT  GTATCTTGTA CAGATATCTT AGCATTAGCA GCAAGGGATG CAGTTTCCGG AGGGCCAACA TGGGATGTGC CAAAAGGAAG AAAGGATGGA AGAGTTTCGA AAGCTACCGA AACACGACAA  TTACCTGCTC CAACATTCAA TATTTCCCAA TTGCAACAAA GTTTTGCACA AAGAGGTCTT TCCATAGATG ATTTAGTTGC ACTATCAGGA GGACATACAC TTGGGTTCGC TCATTGCTCA  TCCTTTCAGA ACAGGATACA CAACTTTAGT TCAAAGCAAA GTGTCGACCC GACTCTGGAA TCATCATTTG CAGCCAGTTT AAAGAGTGTA TGCCCTGCAA CAAACACAGC GAAAAATGCG  GGTGCAAATC TTGATGCGAC TCCCACAACT TTTGACAATA GATATTATAA GTTACTTCTC CAAGGCAAGA GTATATTCTC TTCTGATCAG TCGTTGGTCA CATCGGCAAA GACCAAAGCA  TTGGTCTCAA AGTTTGCTAG CTCACAACAA GAGTTCCAGA AAGCATTTGT GAAATCCATG ATTAAGATGA GTAGCATCAG TGGTGGGCAA GAGGTAAGGC TCGACTGTAG AGTGGTAAAC 
TAA 

Retrieve as FASTA