Entry information : HaPrx86 (HanXRQChr11g0322151)
Entry ID 13640
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx86 (HanXRQChr11g0322151)
Name (synonym) HaPrx86 (HanXRQChr11g0322151)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx86
start..stop
S start..stop
HaPrx84 662 0 1..322 1..322
HaPrx82 640 0 1..322 39..360
HaPrx83 636 0 1..322 1..322
HaPrx87 635 0 1..322 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7463408..7463629 222 N° 2 7463724..7463912 189 N° 3 7464007..7464169 163 N° 4 7464461..7464855 395
join(7463408..7463629,7463724..7463912,7464007..7464169,7464461..7464855)


exon

Literature and cross-references HaPrx86 (HanXRQChr11g0322151)
DNA ref. HanXRQ genome:   HanXRQChr11 (7463408..7464855)
Protein sequence: HaPrx86 (HanXRQChr11g0322151)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322
PWM (Da):   %s   34734.55 Transmb domain:   %s   i7-26o
PI (pH):   %s   9.57
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MADKNTNMFYLIFSFTIFGLAHFNLVNTLSANYYDQTCHNAESTITSVVKKAMLNDPTVPAALLRMHFHDCFIRGCDGSVLLNSTGKNKAEKDGPPNISLHAFYVIDNAKKAVEALCPKTVSCADILALAARDAVTLSGGPTWGVPKGRKDGRVSKATETRQLPAPTFNISQLQQSFAQRGLSMDDLVALSGGHTLGFAHCSSFQNRIHNFSSKQSVDPTLESSFAASLKSVCPAKNTAKNAGANLDSSPTTFDNRYYKLLLQGKSIFSSDQSLVTSAKTKALVSKFASSQQEFQKAFVKSMIKMSSISGGQEVRLDCRVVN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGACAAGAACACCAATATGTTTTACCTTATTTTCAGTTTCACTATCTTTGGATTAGCCCATTTTAACTTGGTTAATACCCTAAGTGCTAATTACTATGATCAAACATGCCACAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCAATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATTAGG
GTGATTATTCTTCTACTT
CTTCCACTTACATGTCATATGCAAAACAGTAAATCATTTTGATTAATTGTTGATTACTAAACTTAAAACTTTGTAGGGGTGTGACGGTTCGGTGTTGCTGAACTCAACCGGGAAGAACAA
AGCTGAGAAAGATGGACCTCCAAACATATCTTTGCATGCATTTTATGTTATTGATAATGCCAAGAAAGCAGTAGAGGCTTTATGTCCTAAAACTGTCTCTTGTGCAGATATCTTGGCATT
AGCAGCAAGGGATGCAGTCACTTTG
GTTAGTAAAGCATCTTTTTTTAGTAACTAAAAGTTTACAAATTTTACAATTTGATTTTAATTTCGTTTCGAGTTTAAACTTGATTTAAATATAGT
CCGGAGGGCCAACATGGGGTGTGCCAAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCTACCGAAACACGACAATTACCAGCTCCAACATTCAATATTTCCCAATTGCAACAAAGTTTTG
CACAAAGAGGTCTTTCCATGGATGATTTAGTTGCGTTATCAG
GTAATTGACCAAATATTACCTAAAATTTCCAGATATCCGGGTTCTTAGTGACTCCATTTTAAACAAAGTAACAAAACT
TTTTGCTCTTTAGTCATAATATTTATCTTATAATTATAGCTAAAAGATATAGTTTTAAAGATTACTCTTATCCTTCAAGAATATATTTTACAAACATATAGTAACTGATTTGTTACACGT
TTTATAAATGTGTCACCCAAAATGTTATTTTTCTTGTAGTAATTTTTTTGAAGCAAACGAAATAAAGATTATTATTTGCTGACCAATGTGTAGGAGGACATACACTTGGGTTCGCTCATT
GCTCATCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCGACTCTGGAATCGTCATTTGCAGCTAGTTTAAAGAGTGTATGCCCTGCAAAAAACACAGCGAAAA
ATGCCGGTGCAAATCTTGATTCGAGTCCCACTACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAGAGTATATTCTCTTCCGATCAGTCGTTGGTCACATCGGCAAAGACCA
AAGCATTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTAAAATCCATGATTAAGATGAGTAGCATCAGTGGTGGGCAAGAGGTAAGGCTCGACTGTAGAGTTG
TAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGACAAGAACACCAATATGTTTTACCTTATTTTCAGTTTCACTATCTTTGGATTAGCCCATTTTAACTTGGTTAATACCCTAAGTGCTAATTACTATGATCAAACATGCCACAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCAATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATTAGG
GGGTGTGACGGTTCGGTG
TTGCTGAACTCAACCGGGAAGAACAAAGCTGAGAAAGATGGACCTCCAAACATATCTTTGCATGCATTTTATGTTATTGATAATGCCAAGAAAGCAGTAGAGGCTTTATGTCCTAAAACT
GTCTCTTGTGCAGATATCTTGGCATTAGCAGCAAGGGATGCAGTCACTTTG
TCCGGAGGGCCAACATGGGGTGTGCCAAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCTACCGAAACA
CGACAATTACCAGCTCCAACATTCAATATTTCCCAATTGCAACAAAGTTTTGCACAAAGAGGTCTTTCCATGGATGATTTAGTTGCGTTATCAG
GAGGACATACACTTGGGTTCGCTCAT
TGCTCATCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCGACTCTGGAATCGTCATTTGCAGCTAGTTTAAAGAGTGTATGCCCTGCAAAAAACACAGCGAAA
AATGCCGGTGCAAATCTTGATTCGAGTCCCACTACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAGAGTATATTCTCTTCCGATCAGTCGTTGGTCACATCGGCAAAGACC
AAAGCATTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTAAAATCCATGATTAAGATGAGTAGCATCAGTGGTGGGCAAGAGGTAAGGCTCGACTGTAGAGTT
GTAAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGACA AGAACACCAA TATGTTTTAC CTTATTTTCA GTTTCACTAT CTTTGGATTA GCCCATTTTA ACTTGGTTAA TACCCTAAGT GCTAATTACT ATGATCAAAC ATGCCACAAT  GCTGAATCAA CCATTACAAG TGTTGTCAAG AAAGCAATGT TGAATGATCC AACAGTTCCT GCTGCACTTC TAAGAATGCA TTTCCATGAT TGCTTCATTA GGGGGTGTGA CGGTTCGGTG  TTGCTGAACT CAACCGGGAA GAACAAAGCT GAGAAAGATG GACCTCCAAA CATATCTTTG CATGCATTTT ATGTTATTGA TAATGCCAAG AAAGCAGTAG AGGCTTTATG TCCTAAAACT  GTCTCTTGTG CAGATATCTT GGCATTAGCA GCAAGGGATG CAGTCACTTT GTCCGGAGGG CCAACATGGG GTGTGCCAAA AGGAAGAAAG GATGGAAGAG TTTCGAAAGC TACCGAAACA  CGACAATTAC CAGCTCCAAC ATTCAATATT TCCCAATTGC AACAAAGTTT TGCACAAAGA GGTCTTTCCA TGGATGATTT AGTTGCGTTA TCAGGAGGAC ATACACTTGG GTTCGCTCAT  TGCTCATCCT TTCAGAACAG GATACACAAC TTTAGTTCAA AGCAAAGTGT CGACCCGACT CTGGAATCGT CATTTGCAGC TAGTTTAAAG AGTGTATGCC CTGCAAAAAA CACAGCGAAA  AATGCCGGTG CAAATCTTGA TTCGAGTCCC ACTACTTTTG ACAATAGATA TTATAAGTTA CTTCTCCAAG GCAAGAGTAT ATTCTCTTCC GATCAGTCGT TGGTCACATC GGCAAAGACC  AAAGCATTGG TCTCAAAGTT TGCTAGCTCA CAACAAGAGT TCCAGAAAGC ATTTGTAAAA TCCATGATTA AGATGAGTAG CATCAGTGGT GGGCAAGAGG TAAGGCTCGA CTGTAGAGTT 
GTAAACTAA 

Retrieve as FASTA