Entry information : HaPrx87 (HanXRQChr11g0322161)
Entry ID 13641
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx87 (HanXRQChr11g0322161)
Name (synonym) HaPrx87 (HanXRQChr11g0322161)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx87
start..stop
S start..stop
HaPrx83 656 0 1..322 1..322
HaPrx82 642 0 1..322 39..360
HaPrx84 640 0 1..322 1..322
HaPrx[P]129 638 0 1..322 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7485299..7485520 222 N° 2 7485612..7485800 189 N° 3 7485895..7486057 163 N° 4 7486394..7486788 395
join(7485299..7485520,7485612..7485800,7485895..7486057,7486394..7486788)


exon

Literature and cross-references HaPrx87 (HanXRQChr11g0322161)
DNA ref. HanXRQ genome:   HanXRQChr11 (7485299..7486788)
Protein sequence: HaPrx87 (HanXRQChr11g0322161)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (301)
PWM (Da):   %s   34569.66 (32320.4) Transmb domain:   %s   i7-26o
PI (pH):   %s   9.74 (9.61) Peptide Signal:   %s   cut: 22 range:22-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKNTNMLSLIFSFIILGLAHLNLVNTLSSKYYDQTCPNAESTITSVVKKAMLNDPTVPAALLRMHFHDCFIRGCDGSVLLNSTGKNKAEKDGPPNISLHAFYVIDNAKKAVEALCPKTVSCADILALAARDAVTLSGGPTWDVPKGRKDGRVSKATETRQLPAPTFNLSQLQQSFAQRGLSMDDLVALSGGHTLGFAHCSSFQNRIHNFSSKQSVDPTLESSFAASLKSVCPAKNTAKNAGANLDATPTTFDNRYYKLLLQGKSIFSSDQSLINSAKTKALVSKFASSQQEFQKAFVKSMIKMSSISGGQEVRLDCRAVN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCAAGAACACCAACATGCTTTCCCTTATTTTCAGTTTCATTATCTTAGGATTAGCCCATCTTAACTTGGTTAATACACTAAGCTCTAAATACTATGATCAAACATGCCCCAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCTATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATTAGG
GTGATTATTCTTCCTCTT
CCACTTACATGTCATATGCAAAACAGTATATCATTTTGATTAATTGTTGATTACTAAACTTACAACTTTGTAGGGGTGTGATGGTTCGGTGTTGTTGAACTCAACCGGGAAGAACAAAGC
TGAGAAAGATGGACCCCCAAACATATCTTTGCATGCATTTTATGTTATTGATAATGCCAAGAAAGCGGTAGAGGCTTTATGTCCTAAAACTGTCTCTTGTGCAGATATCTTGGCATTAGC
AGCAAGGGATGCAGTCACTTTG
GTTAGTAAAGCATCTTTTTTTAATAACTAAAAGTTTACAAATTTTACAATTTGATTTTAATTTCGTTTCGAGTTTAAACTTGATTTGAATATAGTCTG
GAGGGCCAACATGGGATGTGCCAAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCTACCGAAACACGACAATTACCTGCTCCAACATTCAATCTTTCCCAATTGCAACAAAGTTTTGCAC
AAAGAGGTCTTTCCATGGATGATTTAGTTGCACTATCAG
GTAATTAATTGACCAAATATTACCTAAAATTTCCAGATAACCGGAACTGTTTATTTTAACGAGTTGATTTACCTAGAATGT
CCAGATATCCGGGTTCTTAGTGACTCCATTTTAAACAAGACAAAACTTTTTGCTCTTTATAATATTTATCTTAACTATAGCTAAAAGATATAGTTTTAAAGATTACTCTTATCCTTCAAG
AATATATTTTACAAACATATAGTAACTGATTTGTTACACGTTTTATAAATGTGTCACCCAAAATGTTATTTTTCTTGTAGTATTTTTTTTTGAAGCAAACGAAATAAAGATTATTATTTG
CTGACCAATGTGTAGGAGGACATACACTTGGGTTCGCTCATTGCTCATCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCGACTCTGGAATCATCATTTGCAG
CCAGTTTAAAGAGTGTATGCCCTGCAAAAAACACAGCGAAAAATGCGGGTGCAAATCTTGATGCGACTCCCACAACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAGAGTA
TATTCTCTTCTGATCAGTCGTTGATCAATTCGGCAAAGACGAAAGCATTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCCATGATTAAGATGAGCA
GCATCAGTGGTGGGCAAGAGGTAAGGCTCGACTGTAGAGCGGTAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCAAGAACACCAACATGCTTTCCCTTATTTTCAGTTTCATTATCTTAGGATTAGCCCATCTTAACTTGGTTAATACACTAAGCTCTAAATACTATGATCAAACATGCCCCAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCTATGTTGAATGATCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATTAGG
GGGTGTGATGGTTCGGTG
TTGTTGAACTCAACCGGGAAGAACAAAGCTGAGAAAGATGGACCCCCAAACATATCTTTGCATGCATTTTATGTTATTGATAATGCCAAGAAAGCGGTAGAGGCTTTATGTCCTAAAACT
GTCTCTTGTGCAGATATCTTGGCATTAGCAGCAAGGGATGCAGTCACTTTG
TCTGGAGGGCCAACATGGGATGTGCCAAAAGGAAGAAAGGATGGAAGAGTTTCGAAAGCTACCGAAACA
CGACAATTACCTGCTCCAACATTCAATCTTTCCCAATTGCAACAAAGTTTTGCACAAAGAGGTCTTTCCATGGATGATTTAGTTGCACTATCAG
GAGGACATACACTTGGGTTCGCTCAT
TGCTCATCCTTTCAGAACAGGATACACAACTTTAGTTCAAAGCAAAGTGTCGACCCGACTCTGGAATCATCATTTGCAGCCAGTTTAAAGAGTGTATGCCCTGCAAAAAACACAGCGAAA
AATGCGGGTGCAAATCTTGATGCGACTCCCACAACTTTTGACAATAGATATTATAAGTTACTTCTCCAAGGCAAGAGTATATTCTCTTCTGATCAGTCGTTGATCAATTCGGCAAAGACG
AAAGCATTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCCATGATTAAGATGAGCAGCATCAGTGGTGGGCAAGAGGTAAGGCTCGACTGTAGAGCG
GTAAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCA AGAACACCAA CATGCTTTCC CTTATTTTCA GTTTCATTAT CTTAGGATTA GCCCATCTTA ACTTGGTTAA TACACTAAGC TCTAAATACT ATGATCAAAC ATGCCCCAAT  GCTGAATCAA CCATTACAAG TGTTGTCAAG AAAGCTATGT TGAATGATCC AACAGTTCCT GCTGCACTTC TAAGAATGCA TTTCCATGAT TGCTTCATTA GGGGGTGTGA TGGTTCGGTG  TTGTTGAACT CAACCGGGAA GAACAAAGCT GAGAAAGATG GACCCCCAAA CATATCTTTG CATGCATTTT ATGTTATTGA TAATGCCAAG AAAGCGGTAG AGGCTTTATG TCCTAAAACT  GTCTCTTGTG CAGATATCTT GGCATTAGCA GCAAGGGATG CAGTCACTTT GTCTGGAGGG CCAACATGGG ATGTGCCAAA AGGAAGAAAG GATGGAAGAG TTTCGAAAGC TACCGAAACA  CGACAATTAC CTGCTCCAAC ATTCAATCTT TCCCAATTGC AACAAAGTTT TGCACAAAGA GGTCTTTCCA TGGATGATTT AGTTGCACTA TCAGGAGGAC ATACACTTGG GTTCGCTCAT  TGCTCATCCT TTCAGAACAG GATACACAAC TTTAGTTCAA AGCAAAGTGT CGACCCGACT CTGGAATCAT CATTTGCAGC CAGTTTAAAG AGTGTATGCC CTGCAAAAAA CACAGCGAAA  AATGCGGGTG CAAATCTTGA TGCGACTCCC ACAACTTTTG ACAATAGATA TTATAAGTTA CTTCTCCAAG GCAAGAGTAT ATTCTCTTCT GATCAGTCGT TGATCAATTC GGCAAAGACG  AAAGCATTGG TCTCAAAGTT TGCTAGCTCA CAACAAGAGT TCCAGAAAGC ATTTGTGAAA TCCATGATTA AGATGAGCAG CATCAGTGGT GGGCAAGAGG TAAGGCTCGA CTGTAGAGCG 
GTAAACTAAA CCAAACTGGT GGAAAAGGAA GGTGGCTGGC TGTATTATGT TCTTG 

Retrieve as FASTA