Entry information : HaPrx89 (HanXRQChr11g0322191)
Entry ID 13643
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2017-12-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-12-08 (Christophe Dunand)
Peroxidase information: HaPrx89 (HanXRQChr11g0322191)
Name (synonym) HaPrx89 (HanXRQChr11g0322191)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx89
start..stop
S start..stop
HaPrx82 613 0 1..322 39..360
HaPrx83 610 0 1..322 1..322
HaPrx87 609 0 1..322 1..322
HaPrx130 606 0 1..322 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..222 222 N° 2 983..1065 83 N° 3 7459..7564 106 N° 4 7663..7825 163
N° 5 8722..9116 395  
join(1..222,983..1065,7459..7564,7663..7825,8722..9116)


exon

Literature and cross-references HaPrx89 (HanXRQChr11g0322191)
Protein sequence: HaPrx89 (HanXRQChr11g0322191)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322
PWM (Da):   %s   34836.81 Transmb domain:   %s   i7-26o
PI (pH):   %s   9.28
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKNTNIFSLIFSFIFIGLAHLNLVNTLSPNYYDQTCPNAESTITSVVKKAMLNDPTVPAALLRMHFHDCFIRGCDGSVLLNSTEKNIAEKDSPPNISLHAFYVIDNAKKAVEALCPKTVSCADILALAARDAVTSGGPTWDVPKGRKDGRVSKIIETLQLPAQTFNISQLQQSFAQRGLSLDDLVALSGGHTLGFAHCSSFQNRIHNFNSNQSVDPTLESSFAAGLKRACPTKNTAKNAGANLDSTPTTFDNRYYKLLLQGKSIFSSDQSLVTSAKSKALVSKFASSQQEFQKAFVKSMIKMSNINGGQEVRLNCRVVN

Retrieve as FASTA  
Remarks Extra intron in exon 2
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCAAGAACACCAACATCTTTTCTCTTATTTTCAGTTTCATTTTCATAGGTTTAGCCCATCTTAACTTGGTTAATACACTAAGTCCTAATTACTATGATCAAACATGCCCCAAT
GCTGAATCCACCATTACAAGTGTTGTCAAGAAAGCAATGCTTAATGATCCAACAGTTCCTGCCGCACTTCTTAGAATGCACTTCCATGATTGCTTCATCAGG
GTGAGTATTCTTCTTCTT
TTCACTTGAATGGAAAACTTTTTTTAGAAATCGGTCATATATTAAAAATTGTAATCACATAAGGGTATGATTTAGAAAAGTTAATCAAATAGGATATATTGTCGTATTTGGCAAGAGCGA
CATCTCCCAAACACTTTTTATTTTCATTCTTTTTTTTTCAGTTTTGTTTTGAGATCTAATTAATTTTTCTAATAACATGTTATGTGTGACATTTTGAAAAAAAAATTTATGTCTGCTCAA
TGTATGTTTTATTTAAAAATAGTCTTATTTGTATTCAAAATAACATATTTTTTTAACATACAATATTTCAAAATTTTACATCAAAACACTGACAGAAAACATGAAACAAATCTTAGTATT
TATTTTTAATTAAAATATTGGATACTACATGTTAATATTAGAGAAAATCTAGATTTAATATTAAATGAAAACGGAAAAAGAAAAATAAAGGCGATCGAGAAGATGTCGCCCTTGTAAAAT
ACCCGTTGTAATGACAATCGAAACATGGCCATCTAAAGTGGAGGTCAAGAGTTCTTGCCTGGTGCAAAATTGTTCTATGATGAGCCAGAGGTTTTACACAGTGGGCCTCGGGCGATGGGT
TTTCTCTGGAATGGTGGCGGGCCAGTTCGCAGACATGGATGGCCTTTTGCCATTGGATTTACCCGGGTGATCGGGCTATTGTAGTGTCAATTCAGTATAACAAATTTATTAATTATTGAT
TGCTAAATATTTAATTTTGTAGGGATGTGATGGTTCAGTGTTGTTGAATTCGACCGAAAAGAACATAGCTGAGAAAGATTCACCTCCAAACATATCTTTACATGCATTCTATGTTGGTTC
AGTTCTGTTTATACATGAAGGAAAACATGAAAACATACCTGATTGCATCAGCACAAGCCAGCAGAGAATCCAGATGGAGATGTAGCAACAGTGTTTGACATAGTTGTCAGTTTGGTCTGG
TTCCTCCTTAGGGTGCAATCTAATGATGGTGATGAAGAAACCGAATAAGGGAGTTCGGTTATGGAGATGGAGGTCGATTTGATGTTATGAGTAATTAGGTTATGAGTCTAACCCTAGAAC
CTCAAAATAAGTCTCCTTATATATGCACCCAGGAGGAAACCCTAATTAGTTAATAATGGTAATAAGGCCCATCAACAATTACCAACTAATTATTTAATGGATTGTTATATATTTTGATCC
ATATAATGTAAATGATTATAATGGCCATATATAAATAAATATATTATTTATTTATTCTTACATTCTCCCACTTGGCCGAGTAATCATTTACTATGAGTATTAGATAAGCCTGATCAGGAG
TTAACACTCATTTTAGCCTTAAACAAGTACTATAGCAGAAAAATACAGCCGTTGAATCATTATGCAACTCAGGACCCCCATTAATCATACTATAGCCTTAATTTAAAACCTAATCGTTAT
GATCAAAATACGCGTAAGCCCTTTGTTTGATTTGTAACTATATTTGTCTATATGCCATTATGCTAGCTTGACATATTCTTAGAGACATACAAAATCAAACTGATGAGGAAAATTAACTAA
TACTTAGTCATTCATAGTACGATATGCAATTGCGCACGACTATTAATTAATACCCGTCTATGAGCTCTCTTAATAAGACTTATGGGTAATAGCCCTTCAGTTATAGGATCCTTAAGCATA
TCATGAATGTATTCGATACAAAACTTAGTTTCCTCAATTCGTTCATAAACGAATAATTAATTGCGTATCGAAACTTAATGCAGCACCTCTTGAACTGTTACTGTTCAAGGAGTAATGGTA
GCTGACTTTATCACACTAATTCTTCAAAACATTAATTATATGGAGTTAATAAACTTACGAGTCCACTGATAAATTTCCAACAACATTTAGTGACTATATTATGTCGTTATAACTTACGTT
GTTGATATTAGTGCATTATGACTCTTCCATGAGATAGTTTTTGTCTGCTGACATAAAGATATACCCGAAACTACATTTTGTCATCTTTGAATATCTCAAAGTTAGAGTAATAAACCGGTT
TTAATTCTCACTTCTTCTTTAAATTGTAGTCTCTCGTTTCTTTTAAAGATATTGTAATACTCAATTAGATGCTACACATTAATCTAGACATATCTAGTGTGTTGCAATGTGAGTAATATC
TAAACGAGTATAGACTTAAACTTACATAAGGCTTCTAATTAATGAAGCATAAATAAATAATCTCATTTATCCTATTATCCTCTAAAGGAGAGCAATATTGATTGTTACATATGTAAGGAC
CCATTTAATGTTAAACTTATGGAACGAAACTAATATCCCATTGGGTCTATCTCAGTATGTTATGATATCAATCACGTAAGAGATATCTCTGAGTTTTATTATATCAAAGTTTGTGTTAAC
AATGCTTTGACTTATGTAACATATGCTTGTCAAAGAATGTCATCTATATAGACAAGTTTATTTTAGTTGCTCCCACTCATCTTGAGGTAGGTACATTAATCCACTTGATTCTTGATGAAA
ATAATTACGTTAGCTTTTCATCACATTATGATGTTTGCATTAACCCATACATGGATATTATTGGCTTACAAACAAAGTGTTCTTTAACCTTCAGTTTGAAACTTTAGGTTGTTATCTAAT
GAACATGTAAATGTGTCAGCCATTTATTAGGGAAAATCGTTTTAATGTTCATCTAATGTAGCTTAAAACTATTATAAGCTACTAGAACAGTGATGATCCTCAAAGAAATCTTTTGTTAGA
TATGCAATAAAGATTCTTTAATAATTTATCTCTTCCTGAGTACAACCTTTGACAATCAATCATGCTTTTGAGTGTCTTAACGCTTATATTAGGATTTGGTTTAGTCATGAACACTCTTAG
GTAACTTAATCAAATCCCAAACGTTATAAGAACACACAAAGTCAGTTTCACTATAAAACTGTTATATTCCATTCAAATGATTGATTTACACTAATGGCTTAATTTGAAGAGATAGGATCA
GTAAACATTTCCAAAATCCATTTCAACTTCAATTAGGGAGGTTATGTAATCATCAAAGTTAGTAGGCTTTTAAACCTAGATGACCTCCTGAGTTGATTATTGGGTTCATTAGAAGTTTCA
ATTTTATGGATTAGCTCTTGGTTAGGTTGCTATCATTTTCATTCTAAGTTTGTAAGAGTTGGTGCAGTATAGTGTACAAGAGGTGTAATCGGAGTTAAATTCGGAGTGAATTTAATGACA
CTCTTCCCCCCGCCTCTTGTATTCCTTGCAAGTCATAATAAGGACTTTGACTGCTCCCACTGACCTTAGAAATCTTTAGGAACTCAGCATGCTTAGGGTCAACATGTAATGACCAACAAA
TTCTAATAGAGAAACAAGTTAATGACGTTAGTCGTTGTAGTTTCTCTTGTTGAGGATTATGTTATTTTAGGTAAGAAATCTAAGTGCGCACACAATTAGGCAACAATGAAACTTTTGTAA
GAGTAGCATTAGATTTAAGGAGATAAGGTTTGATAGAACAGTGTCGTGATGGAGCGATGTCTTGTACAAGAGGTGTAAATTTAAAATTTTCACTCCCCACCTCTTGCAACTATTGCAAGT
TATTATTAAGACACTTAATGCTCCCACTGATCTTTAATATCTCTAGAATGCTACAAGAGAAGTTTCAATGAGCTACGTGACGTGGGAACCTATCACCTATACGTTAGACTTTATTTGATT
TCTTTAATGTCCAGATATCATAAGAAACTTTAGGGACATATTTAATAGAAATCTGATTAACTACATATATGAATAGAGTTCTTCTAAGACCGTGGGCCATATGCGACAAAATTTAGATAC
AAGTTGATAGTCTTTCAAATGATAAATGAATTATGTCTGAATATTCCATTTGGAATAAGTTCCACGAATGTCAATGAATGACTTATGATGGACCCATACTTATTCCTTAAGCCAAATAAT
ATTTAGGGCTGTAACGTCATGATTTAAAATCACTTAAAATGAGATTAGATGAAAAAATCATCCTCATTAACCATGTTATGATTTCTCATGAATTTTGGTTCTAATGGATGAAATTTATAA
GTCTCATTTTCCTTTTGTCAAATTCTCATTTGCATGATGACAAAAGTTGTGAAAAGTAAGGCATCATCTAGTTTCATCTTAGTAATGTTTCTATCCAGATATTTAGAACAAATAAAATGA
GAGTTTACAGTAAGTGTGACTTTATGTTGACTATGCAAACCTCACAATCTTCATATCTTTGCTTAATTATGATACTATATTCTGATTAATCAGAATATATCAGGTATCGAAAAGCGTTGT
TTGAAGACTGCTTATTATGGCTCTTATAGCCTTAACATTTAATTTTTGTCACTAACTCTCGTGTTAGTTATTTGTCGAGTTCTGGTAAGGAAAACGTATGGAACTAGAGTCAACTAATCA
TGTGTTAATTGGAATATTAAAAATTATCAGACTTAAATATCATTAGGAAGTTACTATCTAATTAATTTATCCAACTGTTCTTTAGAATAATGGATAGTCTCGTTGCTTATGCCTAGTCTA
ATGACATAATAATGCAGTGAGATTTTTCCCTTGAAGAACCTTAACGTTGGGATTAGCACTTATAATTTGTCTATGGACCTTAGAACAATCCTCTCTTAAGGTTTTAGTGGTTGTAAGGTG
AATAACATCTTATTTTCCAGTTTCAAACATTTATTTCTTTGTACATATGTTGCTTATCAACACACTCATTATACTTTGGTACTTTTGAGTGTTATAGCTGATTTATAATGCATCAAATTG
TACAAATGAAAACTTAGTATGTAATGTACTGGAAAATGTACTTATTTCCATGCGTAAGCCCTTAACTTTATGGGTCATGGTATTGTACATTATAATATATTCACATATACCACTTAACCT
TATAATTTATAATTTTAAATGAAGACATGCACCTTAGGAGTTCTAGTGATTATTCCACATATAAGAGATTAGCCTTAGGAAAATCTTAATCTGGAATAACTTTAGTGATAGCATTATGTT
AGAGAGTTCTTGATTATCATAAGAGACATCATGTTCGATTTGTCCTGATCATCATGCTCTAATTTTCTTCTTTATAATCTTTATCAGAAGAGAGCAATAGGATTATCGTGTCTTAAGAAA
TAATCAAGGATTTAATTTAAGAGCTAATTCCAATAGAAACTTTAAATAAAACAAACATTTTGGGTTTAGGAATTAGAGTGGATGAGATATATGTAGAAGTAAATTATAGTGAGTAAAATT
ATGGGTACTTAAAAAAAAAAAAAAACAGACGAAATGATCATAAAAATTAATTAAGGATCATTAATATAAGGATCATTGTGTGAAGAGGTTGTGATATGTCTATTATTAACATCAAAATAA
TAGACTTATTTAAAATTCTACTTAAACGAAGACAAATCAGCTTTGGCCAGAAGTGTAATCATTTAAGCATGTGTGCAAAGTAATCGTGACAAATCAGCTTTGGCCAGAAATGAGACAATC
ACTTTAGTTATGCACTTGTCAAGCATGCTAAACATAAATGAATTAAATCAGCTTTGGCCAGAATTAAGACATTTCACGTTTGTAATGCATACTCAACATAGCTTTTATAATACTTGAACA
ATAAATAGATGCATCAAATCAGCTTTGGCCAGAAGTGATACATCAAAAGCTCATTCAAGTTAAGCCATTTTGGTTTTGTAAATCATTCTTTGATCCTCATTAATTAACTAAATAATTACA
AAAACCAATCATTTAATAGCAAACCACCCGTTAGCGCGGATCGAACTCCGCGGTGAGTTCGCTGGGGGGTGCGGGGAACAGCGTGCCCCCGCCCGGGGTTCGGGGCGGGGCCCCGGAAAA
ATTTTTTCTTTAGTTCACATTTAAACAGCTTAAAATAATGAGATTTCGAGTCGCAACCACGATTTCGAGTAATGATGTTATGGTTGCGAGTCGCAACTACGGTCTCGACTAATGACGTTA
TGGTTGCGAGTCGCAACTACGGTCTCGACTAATGACGTTATGGTTGCGAGTCGCAACTACGGTCTCGACTAATGACGTTATGGTTGCGAGTCGCAACCTCATGGTCTCGAGCAGCAACCT
CATGGTTGCGAGTAGCAACCTCATGGTCTCGAGTAGCAACCTCATGGTCTCGAGTAGCAACCTCATGGTCTCGAGTAGCAACCTCATGGTTGCGAGTAGCAACCTCATGGTCTCGAGTAG
CAACCTCATGGTTGCGAGTAGCAACCTCGTCAACAGCTGTTAATTGTGATATCATAACCGAAAATTCGAAATCTAAGGGATTTTATGATAGTGTTTCCTGTTTTAATAAAGATTTAATTT
TATCAGATATTTCAAAATCATAATCTATTTATCTAATAACAGTTTTTCGAAATCTTTAGAGGACAAAACAGATCAAAAACAGGAAAAACACTTAATAATCCGAATCATATTCCAAAACAT
AATAGAATTTTCGAATTTTCTAAGAACAAGTGATGAACCCTAAAAAAGTAAAACATAAAATTCTGGAACCCGAAACCTGAAAATTAATAATTTTCTAAACAGATTTCGGCTAAAACATAA
ACCAGTTAATTTCGAATAAACATATGATTAAGCTTTTATCCGAAAACTATGATCTCGAGTGGACAAGGCCGACTCGAAACCGGCTGTTATGATTCATAAGGTTTCAAAATTCCGTTTTCC
AAGTTTCAATCCCAGAATTATGGATACGAAAACAGAACTGACTAATCAACATATGCTCTGATACCACATGTTGGTTCAGTTCTGTTTATACATGAAGGAAAACATGAAAACATACCTGAT
TGCATCAGCACAAGCCAGCAGAGAATCCAGATGGAGATGTAGCAACAGTGTTTGACATAGTTGTCAGTTTGGTCTGGTTCCTCCTTAGGGTGCAATCTAATGATGGTGATGAAGAAACCG
AATAAGGGAGTTCGGTTATGGAGATGGAGGTCGATTTGATGTTATGAGTAATTAGGTTATGAGTCTAACCCTAGAACCTCAAAATAAGTCTCCTTATATATGCACCCAGGAGGAAACCCT
AATTAGTTAATAATGGTAATAAGGCCCATCAACAATTACCAACTAATTATTTAATGGATTGTTATATATTTTGATCCATATAATGTAAATGATTATAATGGCCATATATAAATAAATATA
TTATTTATTTATTCTTACATTCTATGTTATTGACAACGCCAAGAAAGCAGTAGAGGCTTTATGTCCTAAAACTGTCTCTTGTGCAGACATCTTAGCATTAGCAGCAAGGGATGCAGTCAC
TTTG
GTCAGTAAAGCATCTTCTTCTTCTAATACCTTAAAGTTTTACATTTTTACATGTTTTCATGTTAAGATTGAATCGGGTTTTGCCGTGATATAATCTAGTCTGGAGGGCCGACATGG
GACGTGCCGAAAGGAAGAAAGGATGGAAGAGTTTCGAAAATAATTGAAACGCTACAATTACCAGCTCAAACATTCAATATTTCCCAATTGCAACAAAGTTTTGCTCAAAGAGGCCTTTCC
TTGGATGATTTAGTTGCACTTTCAG
GTAATTAATTAACTAAATCGTGGACCTTAAAAAAGTGTTTATTTACTTGCAAAAGAATGTAGAAAAAAGAAACTGGCCAAAACATTTTTCTTATT
TATAACTGATAGTTATATATATAGTTTTAGGTAGGGGTGTTCAAGATCGGATTATCCGGTTTTCGGATATCCGAAAACCGGATATCCGAAAATTTCGGATAGTGAATATTGATATCCGAA
TCCGTATCCGAAATTTCGGATACGGATTCAGATATCTAAACGGATATCCGAATTTATAAAAAAAATCAAAAAATCCGTTTCGTGTATAGATTAAAACTAAACTTATATTCGATTTTATAA
ATTTCCAACATTTAAAACTATAAACAATCATAACACATGAATACAATTATTTACTACTTTTTTACTAACTTCTACAATACTTCAAACAAAATATAATGCTCATATACTATATATATTTAT
AAAAAAAAATAATTAGTTTTCGGATATCGGATAATCGGATTATCCGAAATTTTTGAAATTCATATCCGAATCCGAATCTGAAAATTCGGATTATCCGATTTTCGGATATCCGAAATTTCG
GATATCCGAAATTTCGGATATTTCGGATACTGATTTTCGGATATTTCGGATACGGATTTTCGGATATTTCGGATTCGGTTTCGAATCCGGATTTTTTTGAACACCCCTACTTTTAGGTTT
TACAACTTCCGTCTAAACATGTTTCACAAAATGATTATCAATGACCTCTGTCAGTCTAGTACTTTATGTAACACCTTAGTGACTGTTTTCTTACTTTTAGTACTTAATAATTTATTAAGT
GTGTCATCCTAAATGAAAATTTTCTTGTAGCAATTTAAACTTTTTTGAGGCATAGATTATCAATTACCGGTTAATATGTAGGAGGACATACACTTGGGTTCGCTCATTGCTCATCCTTTC
AGAACAGGATACACAACTTTAATTCAAACCAAAGTGTCGACCCGACACTGGAATCGTCATTTGCAGCCGGTTTAAAAAGGGCATGCCCTACAAAAAACACAGCAAAAAATGCAGGTGCGA
ATCTTGATTCGACTCCCACAACTTTTGACAATAGATATTATAAGTTACTTCTGCAAGGTAAGAGTATATTCTCTTCTGATCAATCGTTGGTCACATCGGCAAAGTCTAAAGCACTGGTCT
CAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCCATGATTAAGATGAGTAACATCAATGGTGGGCAAGAGGTTAGGCTCAATTGTAGAGTGGTAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCAAGAACACCAACATCTTTTCTCTTATTTTCAGTTTCATTTTCATAGGTTTAGCCCATCTTAACTTGGTTAATACACTAAGTCCTAATTACTATGATCAAACATGCCCCAAT
GCTGAATCCACCATTACAAGTGTTGTCAAGAAAGCAATGCTTAATGATCCAACAGTTCCTGCCGCACTTCTTAGAATGCACTTCCATGATTGCTTCATCAGG
GGATGTGATGGTTCAGTG
TTGTTGAATTCGACCGAAAAGAACATAGCTGAGAAAGATTCACCTCCAAACATATCTTTACATGC
ATTCTATGTTATTGACAACGCCAAGAAAGCAGTAGAGGCTTTATGTCCTAAAACT
GTCTCTTGTGCAGACATCTTAGCATTAGCAGCAAGGGATGCAGTCACTTTG
TCTGGAGGGCCGACATGGGACGTGCCGAAAGGAAGAAAGGATGGAAGAGTTTCGAAAATAATTGAAACG
CTACAATTACCAGCTCAAACATTCAATATTTCCCAATTGCAACAAAGTTTTGCTCAAAGAGGCCTTTCCTTGGATGATTTAGTTGCACTTTCAG
GAGGACATACACTTGGGTTCGCTCAT
TGCTCATCCTTTCAGAACAGGATACACAACTTTAATTCAAACCAAAGTGTCGACCCGACACTGGAATCGTCATTTGCAGCCGGTTTAAAAAGGGCATGCCCTACAAAAAACACAGCAAAA
AATGCAGGTGCGAATCTTGATTCGACTCCCACAACTTTTGACAATAGATATTATAAGTTACTTCTGCAAGGTAAGAGTATATTCTCTTCTGATCAATCGTTGGTCACATCGGCAAAGTCT
AAAGCACTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTGAAATCCATGATTAAGATGAGTAACATCAATGGTGGGCAAGAGGTTAGGCTCAATTGTAGAGTG
GTAAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CACCAGCTTC ATCCATCAAC CTCAAGCATC ACCCAAAACC CCTTGTTGCA GCTTCCAACA ATGGCAGCCA AGAACACCAA CATCTTTTCT CTTATTTTCA GTTTCATTTT CATAGGTTTA  GCCCATCTTA ACTTGGTTAA TACACTAAGT CCTAATTACT ATGATCAAAC ATGCCCCAAT GCTGAATCCA CCATTACAAG TGTTGTCAAG AAAGCAATGC TTAATGATCC AACAGTTCCT  GCCGCACTTC TTAGAATGCA CTTCCATGAT TGCTTCATCA GGGGATGTGA TGGTTCAGTG TTGTTGAATT CGACCGAAAA GAACATAGCT GAGAAAGATT CACCTCCAAA CATATCTTTA  CATGCATTCT ATGTTATTGA CAACGCCAAG AAAGCAGTAG AGGCTTTATG TCCTAAAACT GTCTCTTGTG CAGACATCTT AGCATTAGCA GCAAGGGATG CAGTCACTTT GTCTGGAGGG  CCGACATGGG ACGTGCCGAA AGGAAGAAAG GATGGAAGAG TTTCGAAAAT AATTGAAACG CTACAATTAC CAGCTCAAAC ATTCAATATT TCCCAATTGC AACAAAGTTT TGCTCAAAGA  GGCCTTTCCT TGGATGATTT AGTTGCACTT TCAGGAGGAC ATACACTTGG GTTCGCTCAT TGCTCATCCT TTCAGAACAG GATACACAAC TTTAATTCAA ACCAAAGTGT CGACCCGACA  CTGGAATCGT CATTTGCAGC CGGTTTAAAA AGGGCATGCC CTACAAAAAA CACAGCAAAA AATGCAGGTG CGAATCTTGA TTCGACTCCC ACAACTTTTG ACAATAGATA TTATAAGTTA  CTTCTGCAAG GTAAGAGTAT ATTCTCTTCT GATCAATCGT TGGTCACATC GGCAAAGTCT AAAGCACTGG TCTCAAAGTT TGCTAGCTCA CAACAAGAGT TCCAGAAAGC ATTTGTGAAA 
TCCATGATTA AGATGAGTAA CATCAATGGT GGGCAAGAGG TTAGGCTCAA TTGTAGAGTG GTAAACTAAA CAAAACTGAG GGGAAAGGAA GGAG 

Retrieve as FASTA